Incidental Mutation 'R4631:Cd163'
ID349187
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4631 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 124329086 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 1122 (*1122Q)
Ref Sequence ENSEMBL: ENSMUSP00000032234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably null
Transcript: ENSMUST00000032234
AA Change: *1122Q
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: *1122Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000112541
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Meta Mutation Damage Score 0.8365 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dlg2 A T 7: 92,088,614 I435F probably damaging Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Ppp1r9a A G 6: 4,906,537 D364G possibly damaging Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Tns3 A C 11: 8,451,119 F1060V probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn1r73 G A 7: 11,756,831 C192Y probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124311312 splice site probably null
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
R7829:Cd163 UTSW 6 124304779 missense probably benign 0.04
R8354:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8454:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8530:Cd163 UTSW 6 124318901 missense probably damaging 1.00
R8560:Cd163 UTSW 6 124317401 missense possibly damaging 0.86
R8878:Cd163 UTSW 6 124320510 missense probably damaging 0.99
R8930:Cd163 UTSW 6 124317923 missense probably damaging 1.00
R8932:Cd163 UTSW 6 124317923 missense probably damaging 1.00
Z1177:Cd163 UTSW 6 124317385 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTCAGAGACTTGAGGCCAG -3'
(R):5'- GGATCCCGTCACATTTCAAAC -3'

Sequencing Primer
(F):5'- AGGGCTGGCATATATTCCCAG -3'
(R):5'- CACACGTCTTAGCAATGGTTGAGTC -3'
Posted On2015-10-08