Incidental Mutation 'R4631:Tns3'
ID349207
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R4631 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8451119 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 1060 (F1060V)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably benign
Transcript: ENSMUST00000020695
AA Change: F1060V

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: F1060V

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129074
Meta Mutation Damage Score 0.1003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Cd163 T C 6: 124,329,086 *1122Q probably null Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dlg2 A T 7: 92,088,614 I435F probably damaging Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Ppp1r9a A G 6: 4,906,537 D364G possibly damaging Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn1r73 G A 7: 11,756,831 C192Y probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
R8790:Tns3 UTSW 11 8518273 missense probably damaging 0.99
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTGGAAGGACATTCGG -3'
(R):5'- TGTCCATGTCAGAGCCTCAG -3'

Sequencing Primer
(F):5'- ATGCTCATGGTGCTGCC -3'
(R):5'- CAGAGCCTCAGGGTGCTTTG -3'
Posted On2015-10-08