Mutagenetix > Incidental Mutation

Incidental Mutation 'R4631:Cntnap3'

349217

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

041896-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R4631 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64778883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 558 (Y558H)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably benign
Transcript: ENSMUST00000091554
AA Change: Y558H

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: Y558H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.1441

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,257,987	L368Q	probably damaging	Het
Abcc2	C	T	19: 43,814,707	P661S	possibly damaging	Het
Adgre4	T	G	17: 55,814,305	M457R	probably null	Het
Ank	C	A	15: 27,467,090	F29L	probably benign	Het
Arhgap20	T	C	9: 51,840,353		probably benign	Het
Atf6	T	C	1: 170,747,197		probably null	Het
Bod1l	A	G	5: 41,817,735	F2079L	probably damaging	Het
Cd163	T	C	6: 124,329,086	*1122Q	probably null	Het
Ces2g	T	C	8: 104,967,462		probably null	Het
Ctsm	T	A	13: 61,537,696	S301C	probably null	Het
Dlc1	A	C	8: 36,937,558		probably null	Het
Dlg2	A	T	7: 92,088,614	I435F	probably damaging	Het
Dnah5	T	C	15: 28,401,953	V3420A	probably damaging	Het
Dnah5	T	A	15: 28,419,994	Y3813N	probably damaging	Het
Dnajc13	A	G	9: 104,190,417	M1181T	probably damaging	Het
Drc3	C	A	11: 60,364,908	T107N	probably benign	Het
Dydc2	T	C	14: 41,049,329	E131G	probably benign	Het
Eif5b	T	C	1: 38,041,747	V723A	probably damaging	Het
Fndc9	C	A	11: 46,237,848	H65N	possibly damaging	Het
Fzd1	A	T	5: 4,755,865	Y572*	probably null	Het
Gm1966	A	G	7: 106,599,523		noncoding transcript	Het
Gm38394	A	T	1: 133,658,744	V285E	probably damaging	Het
Gm5096	G	A	18: 87,756,401	R16H	probably damaging	Het
Gps1	T	A	11: 120,788,239		probably null	Het
Kazn	G	A	4: 142,118,160		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnip1	T	A	11: 33,992,821		noncoding transcript	Het
Kif19a	A	G	11: 114,784,847	I382V	possibly damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Malsu1	A	T	6: 49,084,533	E177V	probably damaging	Het
Man2a2	A	G	7: 80,362,463	F649L	probably benign	Het
Map3k11	A	G	19: 5,690,913	I223V	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Myh9	T	G	15: 77,797,028	D164A	probably damaging	Het
Myo16	T	C	8: 10,506,984	I1040T	probably damaging	Het
Myo18b	C	T	5: 112,846,400	A896T	probably damaging	Het
Myocd	G	T	11: 65,178,859	N798K	probably benign	Het
Olfr1206	C	T	2: 88,864,830	T75I	probably benign	Het
Olfr1288	T	A	2: 111,479,563	W260R	probably damaging	Het
Olfr1458	T	A	19: 13,103,272	I11F	probably benign	Het
Olfr156	T	C	4: 43,820,563	D266G	probably benign	Het
Olfr168	G	A	16: 19,530,141	R260*	probably null	Het
Olfr353	T	G	2: 36,890,618	T77P	probably benign	Het
Olfr68	A	T	7: 103,777,475	L290Q	probably damaging	Het
Pcdh18	T	A	3: 49,756,441	I142F	probably damaging	Het
Pcyox1	T	C	6: 86,389,143	D363G	probably benign	Het
Pcyox1	T	C	6: 86,389,230	E334G	possibly damaging	Het
Pgm1	A	G	5: 64,105,947		probably null	Het
Plagl1	T	G	10: 13,127,999		probably benign	Het
Ppp1r9a	A	G	6: 4,906,537	D364G	possibly damaging	Het
Rab2b	T	A	14: 52,266,242	H141L	possibly damaging	Het
Rev3l	A	G	10: 39,828,416	K279E	probably benign	Het
Rnf111	G	T	9: 70,450,396	T607N	probably benign	Het
Scn8a	C	A	15: 101,016,503	S1130*	probably null	Het
Selenbp1	A	G	3: 94,944,568	*473W	probably null	Het
Sh3bp4	A	C	1: 89,144,273	D281A	probably damaging	Het
Skint5	T	A	4: 113,629,117		probably null	Het
Slc1a4	A	G	11: 20,308,452	L249P	probably damaging	Het
Slc45a2	T	A	15: 11,012,576	S222T	probably benign	Het
Slc7a4	A	G	16: 17,574,391	F393S	probably damaging	Het
Slc9a2	A	T	1: 40,761,918	D536V	possibly damaging	Het
Stra6	T	A	9: 58,140,832		probably benign	Het
Tmem145	A	G	7: 25,307,825	D156G	probably benign	Het
Tns3	A	C	11: 8,451,119	F1060V	probably benign	Het
Trak1	G	A	9: 121,454,425	R419Q	probably benign	Het
Trappc8	A	G	18: 20,867,808	S273P	probably benign	Het
Trmt11	A	G	10: 30,559,204	S320P	probably benign	Het
Ugt1a6a	A	T	1: 88,139,258	Y262F	probably benign	Het
Vmn1r73	G	A	7: 11,756,831	C192Y	probably benign	Het
Vmn2r103	T	C	17: 19,793,696	I250T	probably benign	Het
Vmn2r25	T	A	6: 123,853,003	D63V	possibly damaging	Het
Vps13b	C	T	15: 35,646,132	H1461Y	possibly damaging	Het
Ythdc2	A	T	18: 44,887,631	E1427D	probably benign	Het
Zbtb26	A	G	2: 37,436,956	F23L	probably benign	Het
Zfp62	T	A	11: 49,217,805	*908R	probably null	Het
Zfp975	A	T	7: 42,662,945	N81K	probably benign	Het
Zkscan16	G	A	4: 58,951,918	V198M	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGTCTGCATGGTTGACAATATGC -3'
(R):5'- TCACTGGTCATGCTGAATTTTC -3'

Sequencing Primer
(F):5'- GCATGGTTGACAATATGCAGATAAAC -3'
(R):5'- CCCAACTGTAGTTTCCACTC -3'

Posted On

2015-10-08