Incidental Mutation 'R4631:Vps13b'
ID 349224
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
MMRRC Submission 041896-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4631 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35646278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1461 (H1461Y)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048646
AA Change: H1461Y

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: H1461Y

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226579
Meta Mutation Damage Score 0.1507 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,165,270 (GRCm39) L368Q probably damaging Het
Abcc2 C T 19: 43,803,146 (GRCm39) P661S possibly damaging Het
Adgre4 T G 17: 56,121,305 (GRCm39) M457R probably null Het
Ank C A 15: 27,467,176 (GRCm39) F29L probably benign Het
Arhgap20 T C 9: 51,751,653 (GRCm39) probably benign Het
Atf6 T C 1: 170,574,766 (GRCm39) probably null Het
Bhmt1b G A 18: 87,774,525 (GRCm39) R16H probably damaging Het
Bod1l A G 5: 41,975,078 (GRCm39) F2079L probably damaging Het
Cd163 T C 6: 124,306,045 (GRCm39) *1122Q probably null Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cntnap3 A G 13: 64,926,697 (GRCm39) Y558H probably benign Het
Ctsm T A 13: 61,685,510 (GRCm39) S301C probably null Het
Dlc1 A C 8: 37,404,712 (GRCm39) probably null Het
Dlg2 A T 7: 91,737,822 (GRCm39) I435F probably damaging Het
Dnah5 T C 15: 28,402,099 (GRCm39) V3420A probably damaging Het
Dnah5 T A 15: 28,420,140 (GRCm39) Y3813N probably damaging Het
Dnajc13 A G 9: 104,067,616 (GRCm39) M1181T probably damaging Het
Drc3 C A 11: 60,255,734 (GRCm39) T107N probably benign Het
Dydc2 T C 14: 40,771,286 (GRCm39) E131G probably benign Het
Eif5b T C 1: 38,080,828 (GRCm39) V723A probably damaging Het
Fndc9 C A 11: 46,128,675 (GRCm39) H65N possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Gps1 T A 11: 120,679,065 (GRCm39) probably null Het
Gvin3 A G 7: 106,198,730 (GRCm39) noncoding transcript Het
Kazn G A 4: 141,845,471 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnip1 T A 11: 33,942,821 (GRCm39) noncoding transcript Het
Kif19a A G 11: 114,675,673 (GRCm39) I382V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Malsu1 A T 6: 49,061,467 (GRCm39) E177V probably damaging Het
Man2a2 A G 7: 80,012,211 (GRCm39) F649L probably benign Het
Map3k11 A G 19: 5,740,941 (GRCm39) I223V probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Myh9 T G 15: 77,681,228 (GRCm39) D164A probably damaging Het
Myo16 T C 8: 10,556,984 (GRCm39) I1040T probably damaging Het
Myo18b C T 5: 112,994,266 (GRCm39) A896T probably damaging Het
Myocd G T 11: 65,069,685 (GRCm39) N798K probably benign Het
Or13c7b T C 4: 43,820,563 (GRCm39) D266G probably benign Het
Or1n1b T G 2: 36,780,630 (GRCm39) T77P probably benign Het
Or2l13b G A 16: 19,348,891 (GRCm39) R260* probably null Het
Or4c11 C T 2: 88,695,174 (GRCm39) T75I probably benign Het
Or4g7 T A 2: 111,309,908 (GRCm39) W260R probably damaging Het
Or52a5 A T 7: 103,426,682 (GRCm39) L290Q probably damaging Het
Or5b105 T A 19: 13,080,636 (GRCm39) I11F probably benign Het
Pcdh18 T A 3: 49,710,890 (GRCm39) I142F probably damaging Het
Pcyox1 T C 6: 86,366,212 (GRCm39) E334G possibly damaging Het
Pcyox1 T C 6: 86,366,125 (GRCm39) D363G probably benign Het
Pgm2 A G 5: 64,263,290 (GRCm39) probably null Het
Plagl1 T G 10: 13,003,743 (GRCm39) probably benign Het
Ppp1r9a A G 6: 4,906,537 (GRCm39) D364G possibly damaging Het
Rab2b T A 14: 52,503,699 (GRCm39) H141L possibly damaging Het
Rev3l A G 10: 39,704,412 (GRCm39) K279E probably benign Het
Rnf111 G T 9: 70,357,678 (GRCm39) T607N probably benign Het
Scn8a C A 15: 100,914,384 (GRCm39) S1130* probably null Het
Selenbp1 A G 3: 94,851,879 (GRCm39) *473W probably null Het
Sh3bp4 A C 1: 89,071,995 (GRCm39) D281A probably damaging Het
Skint5 T A 4: 113,486,314 (GRCm39) probably null Het
Slc1a4 A G 11: 20,258,452 (GRCm39) L249P probably damaging Het
Slc45a2 T A 15: 11,012,662 (GRCm39) S222T probably benign Het
Slc7a4 A G 16: 17,392,255 (GRCm39) F393S probably damaging Het
Slc9a2 A T 1: 40,801,078 (GRCm39) D536V possibly damaging Het
Stra6 T A 9: 58,048,115 (GRCm39) probably benign Het
Tmem145 A G 7: 25,007,250 (GRCm39) D156G probably benign Het
Tns3 A C 11: 8,401,119 (GRCm39) F1060V probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Trappc8 A G 18: 21,000,865 (GRCm39) S273P probably benign Het
Trmt11 A G 10: 30,435,200 (GRCm39) S320P probably benign Het
Ugt1a6a A T 1: 88,066,980 (GRCm39) Y262F probably benign Het
Vmn1r73 G A 7: 11,490,758 (GRCm39) C192Y probably benign Het
Vmn2r103 T C 17: 20,013,958 (GRCm39) I250T probably benign Het
Vmn2r25 T A 6: 123,829,962 (GRCm39) D63V possibly damaging Het
Ythdc2 A T 18: 45,020,698 (GRCm39) E1427D probably benign Het
Zbed6 A T 1: 133,586,482 (GRCm39) V285E probably damaging Het
Zbtb26 A G 2: 37,326,968 (GRCm39) F23L probably benign Het
Zfp62 T A 11: 49,108,632 (GRCm39) *908R probably null Het
Zfp975 A T 7: 42,312,369 (GRCm39) N81K probably benign Het
Zkscan16 G A 4: 58,951,918 (GRCm39) V198M probably damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGATACAAGAAGGTCAAAATTCTCGTC -3'
(R):5'- TGCGTGAAGTCAGCGTATG -3'

Sequencing Primer
(F):5'- AATGTGTATTCTGCTTTCATTTTCTG -3'
(R):5'- AAGTCAGCGTATGGGTCCTC -3'
Posted On 2015-10-08