Incidental Mutation 'R4631:Vmn2r103'
ID 349229
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 041896-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4631 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20013958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 250 (I250T)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: I250T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I250T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,165,270 (GRCm39) L368Q probably damaging Het
Abcc2 C T 19: 43,803,146 (GRCm39) P661S possibly damaging Het
Adgre4 T G 17: 56,121,305 (GRCm39) M457R probably null Het
Ank C A 15: 27,467,176 (GRCm39) F29L probably benign Het
Arhgap20 T C 9: 51,751,653 (GRCm39) probably benign Het
Atf6 T C 1: 170,574,766 (GRCm39) probably null Het
Bhmt1b G A 18: 87,774,525 (GRCm39) R16H probably damaging Het
Bod1l A G 5: 41,975,078 (GRCm39) F2079L probably damaging Het
Cd163 T C 6: 124,306,045 (GRCm39) *1122Q probably null Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cntnap3 A G 13: 64,926,697 (GRCm39) Y558H probably benign Het
Ctsm T A 13: 61,685,510 (GRCm39) S301C probably null Het
Dlc1 A C 8: 37,404,712 (GRCm39) probably null Het
Dlg2 A T 7: 91,737,822 (GRCm39) I435F probably damaging Het
Dnah5 T C 15: 28,402,099 (GRCm39) V3420A probably damaging Het
Dnah5 T A 15: 28,420,140 (GRCm39) Y3813N probably damaging Het
Dnajc13 A G 9: 104,067,616 (GRCm39) M1181T probably damaging Het
Drc3 C A 11: 60,255,734 (GRCm39) T107N probably benign Het
Dydc2 T C 14: 40,771,286 (GRCm39) E131G probably benign Het
Eif5b T C 1: 38,080,828 (GRCm39) V723A probably damaging Het
Fndc9 C A 11: 46,128,675 (GRCm39) H65N possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Gps1 T A 11: 120,679,065 (GRCm39) probably null Het
Gvin3 A G 7: 106,198,730 (GRCm39) noncoding transcript Het
Kazn G A 4: 141,845,471 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnip1 T A 11: 33,942,821 (GRCm39) noncoding transcript Het
Kif19a A G 11: 114,675,673 (GRCm39) I382V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Malsu1 A T 6: 49,061,467 (GRCm39) E177V probably damaging Het
Man2a2 A G 7: 80,012,211 (GRCm39) F649L probably benign Het
Map3k11 A G 19: 5,740,941 (GRCm39) I223V probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Myh9 T G 15: 77,681,228 (GRCm39) D164A probably damaging Het
Myo16 T C 8: 10,556,984 (GRCm39) I1040T probably damaging Het
Myo18b C T 5: 112,994,266 (GRCm39) A896T probably damaging Het
Myocd G T 11: 65,069,685 (GRCm39) N798K probably benign Het
Or13c7b T C 4: 43,820,563 (GRCm39) D266G probably benign Het
Or1n1b T G 2: 36,780,630 (GRCm39) T77P probably benign Het
Or2l13b G A 16: 19,348,891 (GRCm39) R260* probably null Het
Or4c11 C T 2: 88,695,174 (GRCm39) T75I probably benign Het
Or4g7 T A 2: 111,309,908 (GRCm39) W260R probably damaging Het
Or52a5 A T 7: 103,426,682 (GRCm39) L290Q probably damaging Het
Or5b105 T A 19: 13,080,636 (GRCm39) I11F probably benign Het
Pcdh18 T A 3: 49,710,890 (GRCm39) I142F probably damaging Het
Pcyox1 T C 6: 86,366,212 (GRCm39) E334G possibly damaging Het
Pcyox1 T C 6: 86,366,125 (GRCm39) D363G probably benign Het
Pgm2 A G 5: 64,263,290 (GRCm39) probably null Het
Plagl1 T G 10: 13,003,743 (GRCm39) probably benign Het
Ppp1r9a A G 6: 4,906,537 (GRCm39) D364G possibly damaging Het
Rab2b T A 14: 52,503,699 (GRCm39) H141L possibly damaging Het
Rev3l A G 10: 39,704,412 (GRCm39) K279E probably benign Het
Rnf111 G T 9: 70,357,678 (GRCm39) T607N probably benign Het
Scn8a C A 15: 100,914,384 (GRCm39) S1130* probably null Het
Selenbp1 A G 3: 94,851,879 (GRCm39) *473W probably null Het
Sh3bp4 A C 1: 89,071,995 (GRCm39) D281A probably damaging Het
Skint5 T A 4: 113,486,314 (GRCm39) probably null Het
Slc1a4 A G 11: 20,258,452 (GRCm39) L249P probably damaging Het
Slc45a2 T A 15: 11,012,662 (GRCm39) S222T probably benign Het
Slc7a4 A G 16: 17,392,255 (GRCm39) F393S probably damaging Het
Slc9a2 A T 1: 40,801,078 (GRCm39) D536V possibly damaging Het
Stra6 T A 9: 58,048,115 (GRCm39) probably benign Het
Tmem145 A G 7: 25,007,250 (GRCm39) D156G probably benign Het
Tns3 A C 11: 8,401,119 (GRCm39) F1060V probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Trappc8 A G 18: 21,000,865 (GRCm39) S273P probably benign Het
Trmt11 A G 10: 30,435,200 (GRCm39) S320P probably benign Het
Ugt1a6a A T 1: 88,066,980 (GRCm39) Y262F probably benign Het
Vmn1r73 G A 7: 11,490,758 (GRCm39) C192Y probably benign Het
Vmn2r25 T A 6: 123,829,962 (GRCm39) D63V possibly damaging Het
Vps13b C T 15: 35,646,278 (GRCm39) H1461Y possibly damaging Het
Ythdc2 A T 18: 45,020,698 (GRCm39) E1427D probably benign Het
Zbed6 A T 1: 133,586,482 (GRCm39) V285E probably damaging Het
Zbtb26 A G 2: 37,326,968 (GRCm39) F23L probably benign Het
Zfp62 T A 11: 49,108,632 (GRCm39) *908R probably null Het
Zfp975 A T 7: 42,312,369 (GRCm39) N81K probably benign Het
Zkscan16 G A 4: 58,951,918 (GRCm39) V198M probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACCATGGTCAGTATCCTTCTC -3'
(R):5'- GAGTCTAACATGAAATAGTCAGCTCTG -3'

Sequencing Primer
(F):5'- TCTCTACCAGATGGCCCCTAAGG -3'
(R):5'- GTCAGCTCTGTCAATAACATGATG -3'
Posted On 2015-10-08