Incidental Mutation 'R0266:Grm8'
ID 34923
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission 038492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0266 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 27275120-28135094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27285895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 839 (Y839C)
Ref Sequence ENSEMBL: ENSMUSP00000110979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324]
AlphaFold P47743
Predicted Effect probably damaging
Transcript: ENSMUST00000090512
AA Change: Y839C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: Y839C

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115323
AA Change: Y839C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: Y839C

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115324
AA Change: Y839C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: Y839C

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Meta Mutation Damage Score 0.9022 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,635,188 (GRCm39) S117P possibly damaging Het
Aars2 T C 17: 45,818,436 (GRCm39) probably benign Het
Acot11 T C 4: 106,607,185 (GRCm39) D466G probably damaging Het
Adgrd1 G A 5: 129,216,658 (GRCm39) A342T probably benign Het
Apbb2 A T 5: 66,459,954 (GRCm39) N714K probably benign Het
Aqp12 C A 1: 92,934,572 (GRCm39) H150N possibly damaging Het
Brinp3 T A 1: 146,558,418 (GRCm39) L114* probably null Het
Ccng2 T C 5: 93,419,148 (GRCm39) probably benign Het
Cd36 T A 5: 18,003,250 (GRCm39) R265S probably benign Het
Ces4a T C 8: 105,868,598 (GRCm39) L104S probably benign Het
Clca4b T C 3: 144,628,547 (GRCm39) I387V probably damaging Het
Cul7 T A 17: 46,965,521 (GRCm39) H566Q probably benign Het
Ddx60 A T 8: 62,486,527 (GRCm39) H1646L possibly damaging Het
Dntt T C 19: 41,047,566 (GRCm39) I503T probably damaging Het
Dynlt1a T G 17: 6,367,670 (GRCm39) E2D probably benign Het
Efemp2 G T 19: 5,528,027 (GRCm39) C78F probably damaging Het
Esco1 T C 18: 10,594,605 (GRCm39) E227G probably benign Het
Fezf2 T A 14: 12,342,607 (GRCm38) K419N probably damaging Het
Gm17541 A T 12: 4,739,487 (GRCm39) probably benign Het
Gm2381 G A 7: 42,469,372 (GRCm39) Q251* probably null Het
Gm4782 T G 6: 50,587,674 (GRCm39) S686R probably damaging Het
Grin3a G A 4: 49,665,501 (GRCm39) R1045* probably null Het
Gtf3c1 G A 7: 125,243,306 (GRCm39) P1766L possibly damaging Het
Herc2 T A 7: 55,856,326 (GRCm39) H3921Q probably damaging Het
Hes6 A T 1: 91,340,026 (GRCm39) D143E possibly damaging Het
Hmcn2 A G 2: 31,284,839 (GRCm39) E2055G probably benign Het
Hmcn2 G A 2: 31,335,365 (GRCm39) probably benign Het
Ikzf3 A G 11: 98,358,143 (GRCm39) L398P probably benign Het
Il10ra A T 9: 45,176,950 (GRCm39) I125N probably benign Het
Kcnb2 G A 1: 15,783,137 (GRCm39) probably benign Het
Krt77 T C 15: 101,777,813 (GRCm39) R81G possibly damaging Het
Lrrc40 T A 3: 157,747,298 (GRCm39) probably null Het
Man1a2 C T 3: 100,489,350 (GRCm39) R543Q probably damaging Het
Mansc1 T C 6: 134,587,670 (GRCm39) D169G probably benign Het
Mdn1 T A 4: 32,741,835 (GRCm39) S3869T probably damaging Het
Mettl14 A T 3: 123,176,475 (GRCm39) S58T probably benign Het
Mrpl4 T C 9: 20,914,610 (GRCm39) V62A probably benign Het
Myh3 A G 11: 66,984,498 (GRCm39) D1085G possibly damaging Het
Myo5c C A 9: 75,191,498 (GRCm39) probably benign Het
Naalad2 G T 9: 18,262,239 (GRCm39) probably benign Het
Nat3 A G 8: 68,000,432 (GRCm39) T104A probably benign Het
Nek4 A G 14: 30,679,253 (GRCm39) E198G probably damaging Het
Olfm1 A G 2: 28,119,619 (GRCm39) Y403C probably damaging Het
Or5w11 C A 2: 87,459,626 (GRCm39) T273K possibly damaging Het
Or7e177 A T 9: 20,212,454 (GRCm39) R320S probably benign Het
Osbpl1a T A 18: 13,004,220 (GRCm39) probably null Het
Pax7 G A 4: 139,507,047 (GRCm39) S330L possibly damaging Het
Pcdhb15 C A 18: 37,608,329 (GRCm39) D520E probably damaging Het
Pgm3 T C 9: 86,449,586 (GRCm39) T145A probably benign Het
Phox2b G A 5: 67,253,968 (GRCm39) probably null Het
Pik3r6 A T 11: 68,417,234 (GRCm39) R59* probably null Het
Pold1 A G 7: 44,190,449 (GRCm39) probably benign Het
Ppp1r21 T C 17: 88,876,500 (GRCm39) probably benign Het
Prl5a1 A G 13: 28,333,970 (GRCm39) K158E possibly damaging Het
Rag2 T G 2: 101,460,948 (GRCm39) C419W probably damaging Het
Reln A G 5: 22,193,774 (GRCm39) S1395P probably damaging Het
Retnlb T G 16: 48,639,022 (GRCm39) Y74* probably null Het
Robo3 A G 9: 37,333,936 (GRCm39) S633P probably damaging Het
Ryr1 A G 7: 28,740,104 (GRCm39) S3941P probably damaging Het
Scnn1b A G 7: 121,511,698 (GRCm39) N370S probably damaging Het
Slc6a5 C A 7: 49,588,156 (GRCm39) probably benign Het
Sort1 T A 3: 108,252,247 (GRCm39) N481K probably benign Het
Sptlc3 T A 2: 139,437,957 (GRCm39) I417K possibly damaging Het
Svil T A 18: 5,099,063 (GRCm39) probably benign Het
Taf4b T C 18: 14,946,134 (GRCm39) probably benign Het
Tchp T C 5: 114,847,394 (GRCm39) M71T possibly damaging Het
Thsd4 T A 9: 59,904,417 (GRCm39) H233L probably benign Het
Tmem217 G T 17: 29,745,573 (GRCm39) N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Uqcrfs1 A C 13: 30,725,146 (GRCm39) N131K probably benign Het
Vars1 T A 17: 35,232,845 (GRCm39) S896R probably benign Het
Vmn1r170 A T 7: 23,305,906 (GRCm39) M103L probably benign Het
Vmn2r22 T C 6: 123,614,363 (GRCm39) Y409C probably damaging Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wdr49 A T 3: 75,359,103 (GRCm39) I8N possibly damaging Het
Zfp648 T A 1: 154,080,632 (GRCm39) Y264N probably damaging Het
Zmym1 A C 4: 126,941,818 (GRCm39) F857V possibly damaging Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27,363,800 (GRCm39) missense probably damaging 1.00
IGL01412:Grm8 APN 6 27,762,460 (GRCm39) missense probably damaging 1.00
IGL02329:Grm8 APN 6 27,363,115 (GRCm39) missense probably damaging 1.00
IGL02342:Grm8 APN 6 27,363,803 (GRCm39) missense probably benign 0.00
IGL02584:Grm8 APN 6 27,762,438 (GRCm39) missense probably benign 0.35
IGL03040:Grm8 APN 6 28,126,122 (GRCm39) start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27,363,262 (GRCm39) missense probably damaging 1.00
IGL03139:Grm8 APN 6 27,618,649 (GRCm39) missense probably damaging 1.00
IGL03287:Grm8 APN 6 27,760,254 (GRCm39) missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27,762,389 (GRCm39) missense probably damaging 0.99
R0347:Grm8 UTSW 6 27,981,221 (GRCm39) missense probably benign 0.37
R0580:Grm8 UTSW 6 27,761,370 (GRCm39) splice site probably benign
R0698:Grm8 UTSW 6 27,363,913 (GRCm39) missense probably damaging 1.00
R0833:Grm8 UTSW 6 27,363,178 (GRCm39) missense probably damaging 1.00
R1301:Grm8 UTSW 6 27,981,200 (GRCm39) missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1471:Grm8 UTSW 6 27,363,308 (GRCm39) missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28,125,852 (GRCm39) missense probably benign 0.01
R1638:Grm8 UTSW 6 28,125,882 (GRCm39) nonsense probably null
R1763:Grm8 UTSW 6 27,285,866 (GRCm39) missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28,125,894 (GRCm39) missense probably damaging 1.00
R1902:Grm8 UTSW 6 27,429,481 (GRCm39) missense probably damaging 1.00
R1916:Grm8 UTSW 6 27,363,583 (GRCm39) missense probably benign 0.01
R2257:Grm8 UTSW 6 27,760,224 (GRCm39) missense probably damaging 0.98
R2351:Grm8 UTSW 6 28,126,118 (GRCm39) missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27,761,241 (GRCm39) missense probably damaging 0.98
R3801:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27,761,228 (GRCm39) nonsense probably null
R3844:Grm8 UTSW 6 27,429,507 (GRCm39) missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27,981,229 (GRCm39) missense probably damaging 1.00
R4077:Grm8 UTSW 6 27,760,208 (GRCm39) missense probably benign 0.01
R4395:Grm8 UTSW 6 27,429,431 (GRCm39) missense probably damaging 0.98
R4436:Grm8 UTSW 6 27,761,237 (GRCm39) missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27,761,295 (GRCm39) missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27,762,418 (GRCm39) missense probably damaging 1.00
R5677:Grm8 UTSW 6 27,761,203 (GRCm39) critical splice donor site probably null
R5983:Grm8 UTSW 6 27,760,220 (GRCm39) missense probably benign 0.03
R5990:Grm8 UTSW 6 27,363,623 (GRCm39) missense probably damaging 1.00
R6365:Grm8 UTSW 6 27,363,226 (GRCm39) missense probably damaging 1.00
R6454:Grm8 UTSW 6 27,363,775 (GRCm39) missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27,363,190 (GRCm39) missense probably damaging 1.00
R6960:Grm8 UTSW 6 27,981,281 (GRCm39) missense probably damaging 0.98
R7194:Grm8 UTSW 6 27,618,486 (GRCm39) missense probably benign 0.01
R7259:Grm8 UTSW 6 27,760,175 (GRCm39) missense probably null 0.99
R7305:Grm8 UTSW 6 27,761,354 (GRCm39) missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27,762,476 (GRCm39) missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27,429,524 (GRCm39) missense probably benign 0.44
R7605:Grm8 UTSW 6 27,618,678 (GRCm39) missense probably damaging 1.00
R7651:Grm8 UTSW 6 27,760,257 (GRCm39) missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27,285,786 (GRCm39) missense probably benign
R7785:Grm8 UTSW 6 27,618,636 (GRCm39) missense probably damaging 0.99
R7898:Grm8 UTSW 6 27,762,422 (GRCm39) missense probably damaging 1.00
R8272:Grm8 UTSW 6 27,363,281 (GRCm39) missense probably damaging 1.00
R8274:Grm8 UTSW 6 27,761,335 (GRCm39) missense probably benign 0.31
R8501:Grm8 UTSW 6 27,618,540 (GRCm39) missense probably damaging 0.98
R8695:Grm8 UTSW 6 28,126,030 (GRCm39) missense probably benign 0.01
R8824:Grm8 UTSW 6 27,761,351 (GRCm39) missense probably damaging 1.00
R8869:Grm8 UTSW 6 27,363,752 (GRCm39) missense probably benign 0.26
R9322:Grm8 UTSW 6 27,363,728 (GRCm39) missense possibly damaging 0.88
R9337:Grm8 UTSW 6 27,761,214 (GRCm39) missense probably benign 0.01
R9518:Grm8 UTSW 6 27,429,469 (GRCm39) missense probably benign 0.01
RF013:Grm8 UTSW 6 27,363,779 (GRCm39) missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28,126,026 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTCCCGCTCTTGACCATCTGAAAG -3'
(R):5'- TTGCAAGAAGGCAATGTAGTGCAAC -3'

Sequencing Primer
(F):5'- CTCTTGACCATCTGAAAGTCTACAG -3'
(R):5'- GTCACAATGAAAGCTTGACTGC -3'
Posted On 2013-05-09