Incidental Mutation 'R4632:Nabp1'
ID 349239
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Name nucleic acid binding protein 1
Synonyms 4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R4632 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 51465862-51478425 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 51474602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 78 (Y78*)
Ref Sequence ENSEMBL: ENSMUSP00000140556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000190103]
AlphaFold Q8BGW5
Predicted Effect probably null
Transcript: ENSMUST00000027279
AA Change: Y78*
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107
AA Change: Y78*

PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185961
Predicted Effect probably benign
Transcript: ENSMUST00000186003
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188303
Predicted Effect probably benign
Transcript: ENSMUST00000189542
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000190103
AA Change: Y78*
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107
AA Change: Y78*

Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R0898:Nabp1 UTSW 1 51471337 missense probably benign
R1608:Nabp1 UTSW 1 51473003 splice site probably null
R1614:Nabp1 UTSW 1 51471352 missense possibly damaging 0.70
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8251:Nabp1 UTSW 1 51477578 missense probably benign 0.04
R8302:Nabp1 UTSW 1 51472339 missense probably benign 0.00
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-10-08