Incidental Mutation 'R4632:Kcnt2'
ID349244
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140523148 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 722 (I722V)
Ref Sequence ENSEMBL: ENSMUSP00000112887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect probably benign
Transcript: ENSMUST00000119786
AA Change: I672V

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: I672V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120709
AA Change: I722V

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: I722V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120796
AA Change: I722V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: I722V

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145077
SMART Domains Protein: ENSMUSP00000123677
Gene: ENSMUSG00000052726

DomainStartEndE-ValueType
Pfam:BK_channel_a 1 88 1.2e-23 PFAM
low complexity region 209 224 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140383047 missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140376384 missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140523190 missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140570461 missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140518948 missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R7958:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7966:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R8040:Kcnt2 UTSW 1 140450217 missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140609660 missense probably benign
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Z1176:Kcnt2 UTSW 1 140376361 missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140609648 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGACAAATGCAACTGTGTTCC -3'
(R):5'- GATTCTATCTCCCAATGATTTGTGCAC -3'

Sequencing Primer
(F):5'- GCAACTGTGTTCCAATTTGTTAG -3'
(R):5'- CCAATAGCAGAACTATGGG -3'
Posted On2015-10-08