Incidental Mutation 'R4632:Olfm5'
ID 349277
Institutional Source Beutler Lab
Gene Symbol Olfm5
Ensembl Gene ENSMUSG00000044265
Gene Name olfactomedin 5
Synonyms E030002O03Rik
MMRRC Submission 041897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4632 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103802220-103814023 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103810100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000052174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000154555]
AlphaFold Q8BU90
Predicted Effect probably benign
Transcript: ENSMUST00000051137
AA Change: D87G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265
AA Change: D87G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154555
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,447 (GRCm39) V44A probably benign Het
Abr C T 11: 76,399,845 (GRCm39) G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,156,208 (GRCm39) probably null Het
Agbl1 A G 7: 76,063,433 (GRCm39) T47A probably benign Het
Akap13 G T 7: 75,316,301 (GRCm39) A1389S possibly damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankar T A 1: 72,686,343 (GRCm39) T1286S probably benign Het
Ankrd13c A G 3: 157,667,939 (GRCm39) H166R probably damaging Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
Arl16 A G 11: 120,356,610 (GRCm39) S130P probably damaging Het
Atp10a A T 7: 58,457,186 (GRCm39) Q895L possibly damaging Het
Atp13a5 T A 16: 29,167,537 (GRCm39) R138W probably damaging Het
Auts2 G A 5: 131,501,113 (GRCm39) T309M probably damaging Het
C6 A T 15: 4,789,350 (GRCm39) K265I probably benign Het
Casz1 A G 4: 149,036,312 (GRCm39) T1525A possibly damaging Het
Cd200l1 T G 16: 45,238,271 (GRCm39) H181P probably benign Het
Chpf2 A G 5: 24,796,829 (GRCm39) T592A probably benign Het
Cilp A T 9: 65,187,162 (GRCm39) T1086S probably benign Het
Cmip A G 8: 118,174,150 (GRCm39) Y410C possibly damaging Het
Csmd3 A G 15: 47,874,605 (GRCm39) C560R probably damaging Het
Dchs1 T A 7: 105,403,562 (GRCm39) E2993D probably benign Het
Dnah7a A G 1: 53,467,110 (GRCm39) F3585L probably damaging Het
Dspp A G 5: 104,325,272 (GRCm39) D545G unknown Het
Dusp7 T A 9: 106,247,965 (GRCm39) S198T possibly damaging Het
Ell2 A T 13: 75,917,693 (GRCm39) Q541L possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Galntl6 T A 8: 58,880,857 (GRCm39) I99F probably damaging Het
Gnat3 G A 5: 18,220,364 (GRCm39) probably null Het
Hykk T C 9: 54,853,800 (GRCm39) I374T probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnt2 A G 1: 140,450,886 (GRCm39) I722V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Krt13 A G 11: 100,012,050 (GRCm39) L91P possibly damaging Het
Krtap4-13 A C 11: 99,700,354 (GRCm39) S102A unknown Het
Lrp2 A G 2: 69,319,473 (GRCm39) probably null Het
Lrriq1 C T 10: 103,057,288 (GRCm39) V171I probably damaging Het
Map3k4 C G 17: 12,451,391 (GRCm39) E1501Q probably damaging Het
Mapk11 C T 15: 89,030,579 (GRCm39) V105M probably damaging Het
Mlph G A 1: 90,867,108 (GRCm39) A377T probably damaging Het
Myo9a G A 9: 59,776,947 (GRCm39) C1115Y probably benign Het
Nabp1 A T 1: 51,513,761 (GRCm39) Y78* probably null Het
Nos2 T C 11: 78,848,417 (GRCm39) F1108S possibly damaging Het
Oas2 T C 5: 120,871,546 (GRCm39) K699R probably benign Het
Oog3 A G 4: 143,884,698 (GRCm39) F413L probably benign Het
Or2c1 C T 16: 3,656,951 (GRCm39) T38M probably damaging Het
Pik3r4 A G 9: 105,532,098 (GRCm39) M557V probably benign Het
Pkhd1l1 A G 15: 44,347,796 (GRCm39) T224A probably benign Het
Pknox2 A G 9: 36,805,709 (GRCm39) S367P probably benign Het
Ppfia2 A G 10: 106,671,905 (GRCm39) probably null Het
Ppm1e G A 11: 87,122,356 (GRCm39) P534S probably damaging Het
Prepl T C 17: 85,390,659 (GRCm39) T100A probably benign Het
Ptpn13 A G 5: 103,717,726 (GRCm39) N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Samd12 T A 15: 53,583,067 (GRCm39) H89L possibly damaging Het
Sephs1 T A 2: 4,901,571 (GRCm39) V211E probably benign Het
Setx C T 2: 29,038,627 (GRCm39) T1704I probably benign Het
Sltm T C 9: 70,486,651 (GRCm39) S439P possibly damaging Het
Sort1 G T 3: 108,253,994 (GRCm39) Q553H probably damaging Het
Svs5 G T 2: 164,079,667 (GRCm39) T80N probably benign Het
Tanc1 C A 2: 59,626,179 (GRCm39) T512K probably damaging Het
Tas2r139 T A 6: 42,118,432 (GRCm39) V188E probably damaging Het
Tesk2 C T 4: 116,598,909 (GRCm39) R6W probably benign Het
Tex101 G T 7: 24,367,793 (GRCm39) C186* probably null Het
Timp2 C T 11: 118,194,598 (GRCm39) S197N probably benign Het
Tmem37 A T 1: 119,995,979 (GRCm39) C33S probably damaging Het
Tmem69 T C 4: 116,410,235 (GRCm39) D245G probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Ube2j2 T A 4: 156,039,715 (GRCm39) I14N probably damaging Het
Ush2a T A 1: 188,128,071 (GRCm39) N694K possibly damaging Het
Utp20 A G 10: 88,614,123 (GRCm39) V1277A probably damaging Het
Vmn2r100 C T 17: 19,752,216 (GRCm39) S753F probably damaging Het
Vmn2r103 T C 17: 20,013,958 (GRCm39) I250T probably benign Het
Zap70 G T 1: 36,817,539 (GRCm39) A261S probably benign Het
Zdhhc6 A G 19: 55,302,741 (GRCm39) W87R probably damaging Het
Zfp410 A T 12: 84,372,510 (GRCm39) D112V probably damaging Het
Zfp462 T C 4: 55,012,981 (GRCm39) F501S probably damaging Het
Other mutations in Olfm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Olfm5 APN 7 103,809,951 (GRCm39) missense possibly damaging 0.77
IGL02097:Olfm5 APN 7 103,803,438 (GRCm39) missense probably benign 0.20
IGL02322:Olfm5 APN 7 103,803,608 (GRCm39) missense probably damaging 1.00
IGL02324:Olfm5 APN 7 103,803,302 (GRCm39) splice site probably null
IGL02702:Olfm5 APN 7 103,803,564 (GRCm39) missense probably damaging 1.00
R0128:Olfm5 UTSW 7 103,810,133 (GRCm39) missense probably benign
R0400:Olfm5 UTSW 7 103,803,386 (GRCm39) missense probably damaging 1.00
R0600:Olfm5 UTSW 7 103,803,076 (GRCm39) nonsense probably null
R0610:Olfm5 UTSW 7 103,803,652 (GRCm39) nonsense probably null
R0699:Olfm5 UTSW 7 103,803,326 (GRCm39) missense probably damaging 1.00
R1960:Olfm5 UTSW 7 103,809,619 (GRCm39) missense possibly damaging 0.85
R1978:Olfm5 UTSW 7 103,813,948 (GRCm39) missense unknown
R2391:Olfm5 UTSW 7 103,810,041 (GRCm39) missense probably benign 0.00
R3774:Olfm5 UTSW 7 103,811,056 (GRCm39) missense possibly damaging 0.67
R4770:Olfm5 UTSW 7 103,809,685 (GRCm39) missense probably benign 0.04
R4838:Olfm5 UTSW 7 103,803,572 (GRCm39) missense probably damaging 1.00
R5274:Olfm5 UTSW 7 103,809,190 (GRCm39) missense probably damaging 1.00
R5455:Olfm5 UTSW 7 103,803,669 (GRCm39) missense probably damaging 0.99
R5930:Olfm5 UTSW 7 103,803,362 (GRCm39) missense probably damaging 1.00
R6416:Olfm5 UTSW 7 103,803,260 (GRCm39) missense probably damaging 1.00
R7126:Olfm5 UTSW 7 103,809,187 (GRCm39) missense probably damaging 1.00
R7535:Olfm5 UTSW 7 103,803,444 (GRCm39) missense possibly damaging 0.92
R7682:Olfm5 UTSW 7 103,810,979 (GRCm39) missense probably null 0.49
R7835:Olfm5 UTSW 7 103,803,652 (GRCm39) nonsense probably null
R8308:Olfm5 UTSW 7 103,803,606 (GRCm39) missense probably damaging 1.00
R8531:Olfm5 UTSW 7 103,803,029 (GRCm39) missense probably benign 0.00
R9035:Olfm5 UTSW 7 103,803,099 (GRCm39) missense probably damaging 1.00
R9072:Olfm5 UTSW 7 103,802,984 (GRCm39) missense probably benign
R9185:Olfm5 UTSW 7 103,810,095 (GRCm39) nonsense probably null
X0011:Olfm5 UTSW 7 103,803,153 (GRCm39) missense possibly damaging 0.91
Z1088:Olfm5 UTSW 7 103,803,357 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTATCTACACACCTGGTTCTG -3'
(R):5'- ACAAGAACTGGAATGTCCTCAGG -3'

Sequencing Primer
(F):5'- ACACACCTGGTTCTGAAGTTG -3'
(R):5'- CTGGAATGTCCTCAGGTAAGAAATG -3'
Posted On 2015-10-08