Incidental Mutation 'R4632:Myo9a'
ID349285
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59869664 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1115 (C1115Y)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably benign
Transcript: ENSMUST00000128341
AA Change: C1115Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: C1115Y

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135298
AA Change: C1115Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: C1115Y

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136740
AA Change: C1115Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: C1115Y

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
R7473:Myo9a UTSW 9 59895244 missense probably benign 0.31
R7723:Myo9a UTSW 9 59779858 missense probably damaging 1.00
R7823:Myo9a UTSW 9 59811950 missense probably damaging 1.00
R7824:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R7965:Myo9a UTSW 9 59788438 missense probably damaging 1.00
R8031:Myo9a UTSW 9 59780091 missense probably benign 0.33
R8055:Myo9a UTSW 9 59907460 missense probably damaging 1.00
R8071:Myo9a UTSW 9 59874648 missense probably benign
R8250:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R8260:Myo9a UTSW 9 59910678 missense probably benign 0.08
R8432:Myo9a UTSW 9 59780265 missense probably damaging 1.00
RF018:Myo9a UTSW 9 59869586 missense probably benign 0.00
RF019:Myo9a UTSW 9 59921772 missense probably benign 0.00
Z1176:Myo9a UTSW 9 59895259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGGTAATGTGACAGCCATTTTC -3'
(R):5'- CTATGAAATCAGAAGGAACGACTGC -3'

Sequencing Primer
(F):5'- CCCTTAGCGATTTTGGAGGAATTACC -3'
(R):5'- GGAACGACTGCTTCATTAAAATAAG -3'
Posted On2015-10-08