Incidental Mutation 'R4632:Utp20'
ID349291
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4632 (G1)
Quality Score205
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88778261 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1277 (V1277A)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: V1277A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: V1277A

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000219662
AA Change: V120A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220275
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Atp13a5 T A 16: 29,348,719 R138W probably damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 intron probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7914:Utp20 UTSW 10 88762770 nonsense probably null
R7916:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7990:Utp20 UTSW 10 88775330 missense probably benign
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGGACAGCTGAGATTTCC -3'
(R):5'- GCTAAACAGAAACCTGGGCATC -3'

Sequencing Primer
(F):5'- ACAGCTGAGATTTCCTTGCAG -3'
(R):5'- GGGCATCCAGAATATGATATCCTGAC -3'
Posted On2015-10-08