Incidental Mutation 'R4632:Vmn2r103'
ID 349316
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 041897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4632 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20013958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 250 (I250T)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: I250T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I250T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,283,447 (GRCm39) V44A probably benign Het
Abr C T 11: 76,399,845 (GRCm39) G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,156,208 (GRCm39) probably null Het
Agbl1 A G 7: 76,063,433 (GRCm39) T47A probably benign Het
Akap13 G T 7: 75,316,301 (GRCm39) A1389S possibly damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankar T A 1: 72,686,343 (GRCm39) T1286S probably benign Het
Ankrd13c A G 3: 157,667,939 (GRCm39) H166R probably damaging Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
Arl16 A G 11: 120,356,610 (GRCm39) S130P probably damaging Het
Atp10a A T 7: 58,457,186 (GRCm39) Q895L possibly damaging Het
Atp13a5 T A 16: 29,167,537 (GRCm39) R138W probably damaging Het
Auts2 G A 5: 131,501,113 (GRCm39) T309M probably damaging Het
C6 A T 15: 4,789,350 (GRCm39) K265I probably benign Het
Casz1 A G 4: 149,036,312 (GRCm39) T1525A possibly damaging Het
Cd200l1 T G 16: 45,238,271 (GRCm39) H181P probably benign Het
Chpf2 A G 5: 24,796,829 (GRCm39) T592A probably benign Het
Cilp A T 9: 65,187,162 (GRCm39) T1086S probably benign Het
Cmip A G 8: 118,174,150 (GRCm39) Y410C possibly damaging Het
Csmd3 A G 15: 47,874,605 (GRCm39) C560R probably damaging Het
Dchs1 T A 7: 105,403,562 (GRCm39) E2993D probably benign Het
Dnah7a A G 1: 53,467,110 (GRCm39) F3585L probably damaging Het
Dspp A G 5: 104,325,272 (GRCm39) D545G unknown Het
Dusp7 T A 9: 106,247,965 (GRCm39) S198T possibly damaging Het
Ell2 A T 13: 75,917,693 (GRCm39) Q541L possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Galntl6 T A 8: 58,880,857 (GRCm39) I99F probably damaging Het
Gnat3 G A 5: 18,220,364 (GRCm39) probably null Het
Hykk T C 9: 54,853,800 (GRCm39) I374T probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnt2 A G 1: 140,450,886 (GRCm39) I722V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Krt13 A G 11: 100,012,050 (GRCm39) L91P possibly damaging Het
Krtap4-13 A C 11: 99,700,354 (GRCm39) S102A unknown Het
Lrp2 A G 2: 69,319,473 (GRCm39) probably null Het
Lrriq1 C T 10: 103,057,288 (GRCm39) V171I probably damaging Het
Map3k4 C G 17: 12,451,391 (GRCm39) E1501Q probably damaging Het
Mapk11 C T 15: 89,030,579 (GRCm39) V105M probably damaging Het
Mlph G A 1: 90,867,108 (GRCm39) A377T probably damaging Het
Myo9a G A 9: 59,776,947 (GRCm39) C1115Y probably benign Het
Nabp1 A T 1: 51,513,761 (GRCm39) Y78* probably null Het
Nos2 T C 11: 78,848,417 (GRCm39) F1108S possibly damaging Het
Oas2 T C 5: 120,871,546 (GRCm39) K699R probably benign Het
Olfm5 T C 7: 103,810,100 (GRCm39) D87G probably benign Het
Oog3 A G 4: 143,884,698 (GRCm39) F413L probably benign Het
Or2c1 C T 16: 3,656,951 (GRCm39) T38M probably damaging Het
Pik3r4 A G 9: 105,532,098 (GRCm39) M557V probably benign Het
Pkhd1l1 A G 15: 44,347,796 (GRCm39) T224A probably benign Het
Pknox2 A G 9: 36,805,709 (GRCm39) S367P probably benign Het
Ppfia2 A G 10: 106,671,905 (GRCm39) probably null Het
Ppm1e G A 11: 87,122,356 (GRCm39) P534S probably damaging Het
Prepl T C 17: 85,390,659 (GRCm39) T100A probably benign Het
Ptpn13 A G 5: 103,717,726 (GRCm39) N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Samd12 T A 15: 53,583,067 (GRCm39) H89L possibly damaging Het
Sephs1 T A 2: 4,901,571 (GRCm39) V211E probably benign Het
Setx C T 2: 29,038,627 (GRCm39) T1704I probably benign Het
Sltm T C 9: 70,486,651 (GRCm39) S439P possibly damaging Het
Sort1 G T 3: 108,253,994 (GRCm39) Q553H probably damaging Het
Svs5 G T 2: 164,079,667 (GRCm39) T80N probably benign Het
Tanc1 C A 2: 59,626,179 (GRCm39) T512K probably damaging Het
Tas2r139 T A 6: 42,118,432 (GRCm39) V188E probably damaging Het
Tesk2 C T 4: 116,598,909 (GRCm39) R6W probably benign Het
Tex101 G T 7: 24,367,793 (GRCm39) C186* probably null Het
Timp2 C T 11: 118,194,598 (GRCm39) S197N probably benign Het
Tmem37 A T 1: 119,995,979 (GRCm39) C33S probably damaging Het
Tmem69 T C 4: 116,410,235 (GRCm39) D245G probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Ube2j2 T A 4: 156,039,715 (GRCm39) I14N probably damaging Het
Ush2a T A 1: 188,128,071 (GRCm39) N694K possibly damaging Het
Utp20 A G 10: 88,614,123 (GRCm39) V1277A probably damaging Het
Vmn2r100 C T 17: 19,752,216 (GRCm39) S753F probably damaging Het
Zap70 G T 1: 36,817,539 (GRCm39) A261S probably benign Het
Zdhhc6 A G 19: 55,302,741 (GRCm39) W87R probably damaging Het
Zfp410 A T 12: 84,372,510 (GRCm39) D112V probably damaging Het
Zfp462 T C 4: 55,012,981 (GRCm39) F501S probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTATCCTTCTCTCTACCAGATGG -3'
(R):5'- AGGCTTCCATGGAATGAGTCTAAC -3'

Sequencing Primer
(F):5'- TCTCTACCAGATGGCCCCTAAGG -3'
(R):5'- GTCAGCTCTGTCAATAACATGATG -3'
Posted On 2015-10-08