Incidental Mutation 'R4633:Cd44'
ID349326
Institutional Source Beutler Lab
Gene Symbol Cd44
Ensembl Gene ENSMUSG00000005087
Gene NameCD44 antigen
SynonymsPgp-1, HERMES, Ly-24
MMRRC Submission 041898-MU
Accession Numbers

Genbank: NM_009851; MGI: 88338

Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location102811141-102901665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102853047 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 214 (D214A)
Ref Sequence ENSEMBL: ENSMUSP00000106825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005218] [ENSMUST00000060516] [ENSMUST00000099673] [ENSMUST00000111190] [ENSMUST00000111191] [ENSMUST00000111192] [ENSMUST00000111194] [ENSMUST00000111198]
Predicted Effect probably benign
Transcript: ENSMUST00000005218
AA Change: D214A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 251 276 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
PDB:2ZPY|B 710 729 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000060516
AA Change: D214A

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 229 239 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
PDB:2ZPY|B 510 529 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099673
AA Change: D214A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
PDB:2ZPY|B 295 314 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111190
AA Change: D214A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 324 337 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
PDB:2ZPY|B 394 413 8e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111191
AA Change: D214A

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
PDB:2ZPY|B 428 447 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111192
AA Change: D214A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 294 307 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
PDB:2ZPY|B 364 383 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111194
AA Change: D214A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
PDB:2ZPY|B 507 526 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111198
AA Change: D214A

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: D214A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
PDB:2ZPY|B 587 606 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124624
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(4) Targeted, other(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Cd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Cd44 APN 2 102855947 missense possibly damaging 0.73
IGL01087:Cd44 APN 2 102822262 missense probably damaging 1.00
IGL01413:Cd44 APN 2 102814287 missense probably damaging 0.99
IGL01830:Cd44 APN 2 102842258 splice site probably benign
IGL02221:Cd44 APN 2 102846513 missense probably benign 0.01
IGL02271:Cd44 APN 2 102831387 missense possibly damaging 0.93
IGL02552:Cd44 APN 2 102848731 missense probably benign 0.01
IGL02861:Cd44 APN 2 102832481 critical splice donor site probably null
IGL03309:Cd44 APN 2 102814177 missense probably damaging 1.00
IGL03352:Cd44 APN 2 102845414 intron probably benign
Jialin UTSW 2 102865370 missense probably damaging 0.99
Kale UTSW 2 102824303 missense probably damaging 0.99
N/A - 535:Cd44 UTSW 2 102814189 missense possibly damaging 0.50
R0488:Cd44 UTSW 2 102834219 splice site probably benign
R1441:Cd44 UTSW 2 102846418 missense probably damaging 0.99
R1482:Cd44 UTSW 2 102831383 missense probably damaging 1.00
R1497:Cd44 UTSW 2 102842955 splice site probably null
R1803:Cd44 UTSW 2 102834252 missense probably damaging 1.00
R1952:Cd44 UTSW 2 102853087 missense probably damaging 0.98
R2093:Cd44 UTSW 2 102814284 missense probably damaging 1.00
R2180:Cd44 UTSW 2 102828610 missense possibly damaging 0.66
R2425:Cd44 UTSW 2 102861586 missense probably damaging 1.00
R3687:Cd44 UTSW 2 102901350 splice site probably null
R3820:Cd44 UTSW 2 102901393 splice site probably null
R3821:Cd44 UTSW 2 102901393 splice site probably null
R3822:Cd44 UTSW 2 102901393 splice site probably null
R4060:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R4647:Cd44 UTSW 2 102837929 missense possibly damaging 0.68
R4780:Cd44 UTSW 2 102861565 missense probably damaging 1.00
R5087:Cd44 UTSW 2 102831354 missense possibly damaging 0.83
R5118:Cd44 UTSW 2 102865370 missense probably damaging 0.99
R5449:Cd44 UTSW 2 102832546 missense probably damaging 1.00
R5642:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R5928:Cd44 UTSW 2 102824303 missense probably damaging 0.99
R5995:Cd44 UTSW 2 102861670 missense probably damaging 1.00
R5999:Cd44 UTSW 2 102845397 missense probably benign 0.42
R7050:Cd44 UTSW 2 102814137 missense probably damaging 0.99
R7350:Cd44 UTSW 2 102834262 missense probably benign 0.19
R7797:Cd44 UTSW 2 102848734 missense probably benign 0.34
R7866:Cd44 UTSW 2 102842259 critical splice donor site probably null
R8138:Cd44 UTSW 2 102832497 missense probably benign 0.00
R8185:Cd44 UTSW 2 102824320 missense possibly damaging 0.52
R8732:Cd44 UTSW 2 102834300 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGCACAATGACCAGGAAC -3'
(R):5'- AGCTATTGTCAACCGTGATGG -3'

Sequencing Primer
(F):5'- CTGACAGGAACAAGAGCTGGACTC -3'
(R):5'- TGATGGTACTCGCTACAGCAAG -3'
Posted On2015-10-08