Incidental Mutation 'R4633:Fzd1'
ID349336
Institutional Source Beutler Lab
Gene Symbol Fzd1
Ensembl Gene ENSMUSG00000044674
Gene Namefrizzled class receptor 1
SynonymsFZ-1, Fz1
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4753839-4758035 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4755865 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 572 (Y572*)
Ref Sequence ENSEMBL: ENSMUSP00000058629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054294]
Predicted Effect probably null
Transcript: ENSMUST00000054294
AA Change: Y572*
SMART Domains Protein: ENSMUSP00000058629
Gene: ENSMUSG00000044674
AA Change: Y572*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 71 96 N/A INTRINSIC
FRI 110 227 7.77e-72 SMART
low complexity region 249 262 N/A INTRINSIC
Frizzled 304 635 4.18e-224 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Fzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Fzd1 APN 5 4756037 missense probably benign 0.11
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0402:Fzd1 UTSW 5 4755702 missense possibly damaging 0.46
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1585:Fzd1 UTSW 5 4756278 missense probably damaging 1.00
R1606:Fzd1 UTSW 5 4757514 nonsense probably null
R1708:Fzd1 UTSW 5 4755791 missense possibly damaging 0.82
R1767:Fzd1 UTSW 5 4756812 missense probably benign
R1803:Fzd1 UTSW 5 4756385 missense probably damaging 0.97
R1909:Fzd1 UTSW 5 4757481 missense probably benign 0.01
R2990:Fzd1 UTSW 5 4755758 missense probably damaging 0.98
R4446:Fzd1 UTSW 5 4755777 missense probably damaging 1.00
R4631:Fzd1 UTSW 5 4755865 nonsense probably null
R4632:Fzd1 UTSW 5 4755865 nonsense probably null
R5110:Fzd1 UTSW 5 4756448 missense probably benign 0.00
R6406:Fzd1 UTSW 5 4756089 missense probably damaging 1.00
R6489:Fzd1 UTSW 5 4757336 missense probably benign 0.33
R6642:Fzd1 UTSW 5 4755696 missense probably damaging 1.00
R7095:Fzd1 UTSW 5 4755824 small deletion probably benign
R7150:Fzd1 UTSW 5 4756145 missense probably benign 0.14
R7204:Fzd1 UTSW 5 4755980 missense probably damaging 1.00
R8290:Fzd1 UTSW 5 4757060 missense possibly damaging 0.90
R8354:Fzd1 UTSW 5 4757336 missense probably benign 0.18
R8454:Fzd1 UTSW 5 4757336 missense probably benign 0.18
X0028:Fzd1 UTSW 5 4756958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTTTCAGACGGTAGTC -3'
(R):5'- TCCGCACCATCATGAAGCATG -3'

Sequencing Primer
(F):5'- GGTAAGCCTCGTGTAGAACTTCC -3'
(R):5'- TCATGAAGCATGACGGCAC -3'
Posted On2015-10-08