Incidental Mutation 'R4633:Fanci'
ID349347
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R4633 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79427242 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 576 (L576P)
Ref Sequence ENSEMBL: ENSMUSP00000117992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091] [ENSMUST00000137667] [ENSMUST00000205817]
Predicted Effect probably damaging
Transcript: ENSMUST00000036865
AA Change: L604P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: L604P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117227
AA Change: L604P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112383
Gene: ENSMUSG00000039187
AA Change: L604P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 4.5e-29 PFAM
Pfam:FANCI_S1 60 281 2.9e-80 PFAM
Pfam:FANCI_HD1 284 371 5.2e-37 PFAM
Pfam:FANCI_S2 377 541 2.8e-56 PFAM
Pfam:FANCI_HD2 551 786 2.8e-99 PFAM
Pfam:FANCI_S3 803 1029 1.3e-90 PFAM
Pfam:FANCI_S4 1039 1292 1.4e-106 PFAM
low complexity region 1294 1302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137667
AA Change: L576P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117992
Gene: ENSMUSG00000039187
AA Change: L576P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 25 7.2e-11 PFAM
Pfam:FANCI_S1 32 253 3.4e-80 PFAM
Pfam:FANCI_HD1 256 343 7.3e-37 PFAM
Pfam:FANCI_S2 349 513 8.5e-56 PFAM
Pfam:FANCI_HD2 523 758 9.3e-99 PFAM
Pfam:FANCI_S3 775 850 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205817
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
BB005:Fanci UTSW 7 79444711 missense probably benign
BB015:Fanci UTSW 7 79444711 missense probably benign
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R1815:Fanci UTSW 7 79438308 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5919:Fanci UTSW 7 79444738 missense probably damaging 1.00
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6436:Fanci UTSW 7 79440698 missense probably benign 0.03
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
R7554:Fanci UTSW 7 79412752 missense probably damaging 0.99
R7588:Fanci UTSW 7 79434269 missense possibly damaging 0.81
R7644:Fanci UTSW 7 79444471 nonsense probably null
R7697:Fanci UTSW 7 79406292 critical splice donor site probably null
R7732:Fanci UTSW 7 79412652 missense possibly damaging 0.65
R7928:Fanci UTSW 7 79444711 missense probably benign
R8170:Fanci UTSW 7 79433557 splice site probably null
R8355:Fanci UTSW 7 79435281 missense probably damaging 1.00
R8425:Fanci UTSW 7 79433541 missense probably benign 0.07
R8429:Fanci UTSW 7 79438385 missense possibly damaging 0.65
R8455:Fanci UTSW 7 79435281 missense probably damaging 1.00
R8720:Fanci UTSW 7 79439677 missense possibly damaging 0.92
R8786:Fanci UTSW 7 79402550 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCACAACCTCCTTAGCGG -3'
(R):5'- CAGACCGGTAAATTAGCAGTAAATC -3'

Sequencing Primer
(F):5'- CGGAAACCGCCTGAGAAG -3'
(R):5'- GGTTACGATCCATCAACTATTTACG -3'
Posted On2015-10-08