Incidental Mutation 'R0266:Ddx60'
ID 34935
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 038492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R0266 (G1)
Quality Score 188
Status Validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62486527 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1646 (H1646L)
Ref Sequence ENSEMBL: ENSMUSP00000070741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000070631
AA Change: H1646L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: H1646L

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: H1647L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: H1647L

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136121
Meta Mutation Damage Score 0.7539 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,635,188 (GRCm39) S117P possibly damaging Het
Aars2 T C 17: 45,818,436 (GRCm39) probably benign Het
Acot11 T C 4: 106,607,185 (GRCm39) D466G probably damaging Het
Adgrd1 G A 5: 129,216,658 (GRCm39) A342T probably benign Het
Apbb2 A T 5: 66,459,954 (GRCm39) N714K probably benign Het
Aqp12 C A 1: 92,934,572 (GRCm39) H150N possibly damaging Het
Brinp3 T A 1: 146,558,418 (GRCm39) L114* probably null Het
Ccng2 T C 5: 93,419,148 (GRCm39) probably benign Het
Cd36 T A 5: 18,003,250 (GRCm39) R265S probably benign Het
Ces4a T C 8: 105,868,598 (GRCm39) L104S probably benign Het
Clca4b T C 3: 144,628,547 (GRCm39) I387V probably damaging Het
Cul7 T A 17: 46,965,521 (GRCm39) H566Q probably benign Het
Dntt T C 19: 41,047,566 (GRCm39) I503T probably damaging Het
Dynlt1a T G 17: 6,367,670 (GRCm39) E2D probably benign Het
Efemp2 G T 19: 5,528,027 (GRCm39) C78F probably damaging Het
Esco1 T C 18: 10,594,605 (GRCm39) E227G probably benign Het
Fezf2 T A 14: 12,342,607 (GRCm38) K419N probably damaging Het
Gm17541 A T 12: 4,739,487 (GRCm39) probably benign Het
Gm2381 G A 7: 42,469,372 (GRCm39) Q251* probably null Het
Gm4782 T G 6: 50,587,674 (GRCm39) S686R probably damaging Het
Grin3a G A 4: 49,665,501 (GRCm39) R1045* probably null Het
Grm8 T C 6: 27,285,895 (GRCm39) Y839C probably damaging Het
Gtf3c1 G A 7: 125,243,306 (GRCm39) P1766L possibly damaging Het
Herc2 T A 7: 55,856,326 (GRCm39) H3921Q probably damaging Het
Hes6 A T 1: 91,340,026 (GRCm39) D143E possibly damaging Het
Hmcn2 A G 2: 31,284,839 (GRCm39) E2055G probably benign Het
Hmcn2 G A 2: 31,335,365 (GRCm39) probably benign Het
Ikzf3 A G 11: 98,358,143 (GRCm39) L398P probably benign Het
Il10ra A T 9: 45,176,950 (GRCm39) I125N probably benign Het
Kcnb2 G A 1: 15,783,137 (GRCm39) probably benign Het
Krt77 T C 15: 101,777,813 (GRCm39) R81G possibly damaging Het
Lrrc40 T A 3: 157,747,298 (GRCm39) probably null Het
Man1a2 C T 3: 100,489,350 (GRCm39) R543Q probably damaging Het
Mansc1 T C 6: 134,587,670 (GRCm39) D169G probably benign Het
Mdn1 T A 4: 32,741,835 (GRCm39) S3869T probably damaging Het
Mettl14 A T 3: 123,176,475 (GRCm39) S58T probably benign Het
Mrpl4 T C 9: 20,914,610 (GRCm39) V62A probably benign Het
Myh3 A G 11: 66,984,498 (GRCm39) D1085G possibly damaging Het
Myo5c C A 9: 75,191,498 (GRCm39) probably benign Het
Naalad2 G T 9: 18,262,239 (GRCm39) probably benign Het
Nat3 A G 8: 68,000,432 (GRCm39) T104A probably benign Het
Nek4 A G 14: 30,679,253 (GRCm39) E198G probably damaging Het
Olfm1 A G 2: 28,119,619 (GRCm39) Y403C probably damaging Het
Or5w11 C A 2: 87,459,626 (GRCm39) T273K possibly damaging Het
Or7e177 A T 9: 20,212,454 (GRCm39) R320S probably benign Het
Osbpl1a T A 18: 13,004,220 (GRCm39) probably null Het
Pax7 G A 4: 139,507,047 (GRCm39) S330L possibly damaging Het
Pcdhb15 C A 18: 37,608,329 (GRCm39) D520E probably damaging Het
Pgm3 T C 9: 86,449,586 (GRCm39) T145A probably benign Het
Phox2b G A 5: 67,253,968 (GRCm39) probably null Het
Pik3r6 A T 11: 68,417,234 (GRCm39) R59* probably null Het
Pold1 A G 7: 44,190,449 (GRCm39) probably benign Het
Ppp1r21 T C 17: 88,876,500 (GRCm39) probably benign Het
Prl5a1 A G 13: 28,333,970 (GRCm39) K158E possibly damaging Het
Rag2 T G 2: 101,460,948 (GRCm39) C419W probably damaging Het
Reln A G 5: 22,193,774 (GRCm39) S1395P probably damaging Het
Retnlb T G 16: 48,639,022 (GRCm39) Y74* probably null Het
Robo3 A G 9: 37,333,936 (GRCm39) S633P probably damaging Het
Ryr1 A G 7: 28,740,104 (GRCm39) S3941P probably damaging Het
Scnn1b A G 7: 121,511,698 (GRCm39) N370S probably damaging Het
Slc6a5 C A 7: 49,588,156 (GRCm39) probably benign Het
Sort1 T A 3: 108,252,247 (GRCm39) N481K probably benign Het
Sptlc3 T A 2: 139,437,957 (GRCm39) I417K possibly damaging Het
Svil T A 18: 5,099,063 (GRCm39) probably benign Het
Taf4b T C 18: 14,946,134 (GRCm39) probably benign Het
Tchp T C 5: 114,847,394 (GRCm39) M71T possibly damaging Het
Thsd4 T A 9: 59,904,417 (GRCm39) H233L probably benign Het
Tmem217 G T 17: 29,745,573 (GRCm39) N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Uqcrfs1 A C 13: 30,725,146 (GRCm39) N131K probably benign Het
Vars1 T A 17: 35,232,845 (GRCm39) S896R probably benign Het
Vmn1r170 A T 7: 23,305,906 (GRCm39) M103L probably benign Het
Vmn2r22 T C 6: 123,614,363 (GRCm39) Y409C probably damaging Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wdr49 A T 3: 75,359,103 (GRCm39) I8N possibly damaging Het
Zfp648 T A 1: 154,080,632 (GRCm39) Y264N probably damaging Het
Zmym1 A C 4: 126,941,818 (GRCm39) F857V possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTAAGTTGTAAGCCTCTGTCCATGTGA -3'
(R):5'- GCCACAATACTGGAGTTTGAGAGTGAT -3'

Sequencing Primer
(F):5'- AGCCTCTGTCCATGTGAATAAC -3'
(R):5'- AAATGCCAGATTGCTATCTGCC -3'
Posted On 2013-05-09