Incidental Mutation 'R0266:Ddx60'
ID34935
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 038492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R0266 (G1)
Quality Score188
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62033493 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1646 (H1646L)
Ref Sequence ENSEMBL: ENSMUSP00000070741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070631
AA Change: H1646L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: H1646L

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: H1647L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: H1647L

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136121
Meta Mutation Damage Score 0.7539 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,754 S117P possibly damaging Het
Aars2 T C 17: 45,507,510 probably benign Het
Acot11 T C 4: 106,749,988 D466G probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Apbb2 A T 5: 66,302,611 N714K probably benign Het
Aqp12 C A 1: 93,006,850 H150N possibly damaging Het
Brinp3 T A 1: 146,682,680 L114* probably null Het
Ccng2 T C 5: 93,271,289 probably benign Het
Cd36 T A 5: 17,798,252 R265S probably benign Het
Ces4a T C 8: 105,141,966 L104S probably benign Het
Clca4b T C 3: 144,922,786 I387V probably damaging Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Dntt T C 19: 41,059,127 I503T probably damaging Het
Dynlt1a T G 17: 6,317,395 E2D probably benign Het
Efemp2 G T 19: 5,477,999 C78F probably damaging Het
Esco1 T C 18: 10,594,605 E227G probably benign Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm17541 A T 12: 4,689,487 probably benign Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm4782 T G 6: 50,610,694 S686R probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Grm8 T C 6: 27,285,896 Y839C probably damaging Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hes6 A T 1: 91,412,304 D143E possibly damaging Het
Hmcn2 A G 2: 31,394,827 E2055G probably benign Het
Hmcn2 G A 2: 31,445,353 probably benign Het
Ikzf3 A G 11: 98,467,317 L398P probably benign Het
Il10ra A T 9: 45,265,652 I125N probably benign Het
Kcnb2 G A 1: 15,712,913 probably benign Het
Krt77 T C 15: 101,869,378 R81G possibly damaging Het
Lrrc40 T A 3: 158,041,661 probably null Het
Man1a2 C T 3: 100,582,034 R543Q probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mettl14 A T 3: 123,382,826 S58T probably benign Het
Mrpl4 T C 9: 21,003,314 V62A probably benign Het
Myh3 A G 11: 67,093,672 D1085G possibly damaging Het
Myo5c C A 9: 75,284,216 probably benign Het
Naalad2 G T 9: 18,350,943 probably benign Het
Nat3 A G 8: 67,547,780 T104A probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfm1 A G 2: 28,229,607 Y403C probably damaging Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr873 A T 9: 20,301,158 R320S probably benign Het
Osbpl1a T A 18: 12,871,163 probably null Het
Pax7 G A 4: 139,779,736 S330L possibly damaging Het
Pcdhb15 C A 18: 37,475,276 D520E probably damaging Het
Pgm3 T C 9: 86,567,533 T145A probably benign Het
Phox2b G A 5: 67,096,625 probably null Het
Pik3r6 A T 11: 68,526,408 R59* probably null Het
Pold1 A G 7: 44,541,025 probably benign Het
Ppp1r21 T C 17: 88,569,072 probably benign Het
Prl5a1 A G 13: 28,149,987 K158E possibly damaging Het
Rag2 T G 2: 101,630,603 C419W probably damaging Het
Reln A G 5: 21,988,776 S1395P probably damaging Het
Retnlb T G 16: 48,818,659 Y74* probably null Het
Robo3 A G 9: 37,422,640 S633P probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Slc6a5 C A 7: 49,938,408 probably benign Het
Sort1 T A 3: 108,344,931 N481K probably benign Het
Sptlc3 T A 2: 139,596,037 I417K possibly damaging Het
Svil T A 18: 5,099,063 probably benign Het
Taf4b T C 18: 14,813,077 probably benign Het
Tchp T C 5: 114,709,333 M71T possibly damaging Het
Thsd4 T A 9: 59,997,134 H233L probably benign Het
Tmem217 G T 17: 29,526,599 N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Uqcrfs1 A C 13: 30,541,163 N131K probably benign Het
Vars T A 17: 35,013,869 S896R probably benign Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wdr49 A T 3: 75,451,796 I8N possibly damaging Het
Zfp648 T A 1: 154,204,886 Y264N probably damaging Het
Zmym1 A C 4: 127,048,025 F857V possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7987:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTAAGTTGTAAGCCTCTGTCCATGTGA -3'
(R):5'- GCCACAATACTGGAGTTTGAGAGTGAT -3'

Sequencing Primer
(F):5'- AGCCTCTGTCCATGTGAATAAC -3'
(R):5'- AAATGCCAGATTGCTATCTGCC -3'
Posted On2013-05-09