Incidental Mutation 'R4633:Csmd1'
ID 349352
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene Name CUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 041898-MU
Accession Numbers

Genbank: NM_053171.2
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4633 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 15892537-17535586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16002620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 2168 (I2168T)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082104
AA Change: I2168T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: I2168T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Meta Mutation Damage Score 0.1404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
ikura UTSW 8 16231271 missense probably damaging 1.00
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
PIT4260001:Csmd1 UTSW 8 16070313 missense probably damaging 1.00
PIT4378001:Csmd1 UTSW 8 15895728 missense probably damaging 0.99
PIT4520001:Csmd1 UTSW 8 15906023 missense probably benign 0.01
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17027323 missense probably damaging 0.97
R0505:Csmd1 UTSW 8 15992758 missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0511:Csmd1 UTSW 8 15932529 missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15918208 missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15906116 missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 splice site probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
R7112:Csmd1 UTSW 8 16101128 missense probably damaging 1.00
R7124:Csmd1 UTSW 8 15903202 missense probably damaging 1.00
R7167:Csmd1 UTSW 8 15926524 missense probably benign
R7243:Csmd1 UTSW 8 15915357 missense probably damaging 1.00
R7260:Csmd1 UTSW 8 16000574 missense probably damaging 1.00
R7271:Csmd1 UTSW 8 17027279 missense probably damaging 0.99
R7324:Csmd1 UTSW 8 16058707 missense probably damaging 1.00
R7325:Csmd1 UTSW 8 16058707 missense probably damaging 1.00
R7327:Csmd1 UTSW 8 16058707 missense probably damaging 1.00
R7373:Csmd1 UTSW 8 15992713 missense probably damaging 1.00
R7406:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R7427:Csmd1 UTSW 8 16023850 missense possibly damaging 0.91
R7428:Csmd1 UTSW 8 16023850 missense possibly damaging 0.91
R7445:Csmd1 UTSW 8 16158254 missense possibly damaging 0.61
R7458:Csmd1 UTSW 8 15953738 missense probably damaging 1.00
R7476:Csmd1 UTSW 8 15895731 missense probably damaging 1.00
R7527:Csmd1 UTSW 8 16211718 missense probably damaging 1.00
R7544:Csmd1 UTSW 8 16092296 missense probably damaging 1.00
R7583:Csmd1 UTSW 8 15998833 missense probably damaging 0.96
R7603:Csmd1 UTSW 8 16288682 missense probably damaging 1.00
R7607:Csmd1 UTSW 8 15918331 missense possibly damaging 0.94
R7642:Csmd1 UTSW 8 16085178 missense probably damaging 0.99
R7669:Csmd1 UTSW 8 15917273 missense probably damaging 1.00
R7720:Csmd1 UTSW 8 15931108 missense probably damaging 1.00
R7728:Csmd1 UTSW 8 16231271 missense probably damaging 1.00
R7738:Csmd1 UTSW 8 16100990 missense probably damaging 1.00
R7745:Csmd1 UTSW 8 15932461 critical splice donor site probably null
R7879:Csmd1 UTSW 8 16391806 missense probably benign 0.28
R7884:Csmd1 UTSW 8 15961418 missense probably damaging 1.00
R7897:Csmd1 UTSW 8 17534919 missense possibly damaging 0.96
R8111:Csmd1 UTSW 8 15917306 missense probably benign
R8119:Csmd1 UTSW 8 17027294 missense probably damaging 0.99
R8134:Csmd1 UTSW 8 15932550 missense probably damaging 0.99
R8187:Csmd1 UTSW 8 16127174 missense probably damaging 0.99
R8196:Csmd1 UTSW 8 16009468 missense probably benign 0.18
R8231:Csmd1 UTSW 8 16697923 missense possibly damaging 0.82
R8242:Csmd1 UTSW 8 16710654 missense probably benign 0.42
R8274:Csmd1 UTSW 8 15910453 missense possibly damaging 0.93
R8286:Csmd1 UTSW 8 15989188 missense probably benign 0.18
R8289:Csmd1 UTSW 8 16058702 missense probably damaging 0.99
R8314:Csmd1 UTSW 8 16158244 missense probably benign
R8323:Csmd1 UTSW 8 17216735 nonsense probably null
R8387:Csmd1 UTSW 8 16000484 missense possibly damaging 0.94
R8413:Csmd1 UTSW 8 15900676 missense probably damaging 0.98
R8672:Csmd1 UTSW 8 15926598 missense probably benign 0.01
R8765:Csmd1 UTSW 8 16710611 nonsense probably null
R8789:Csmd1 UTSW 8 17216706 missense probably damaging 0.99
R8828:Csmd1 UTSW 8 15998794 missense probably benign 0.00
R8858:Csmd1 UTSW 8 16070304 missense probably benign 0.10
R8878:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R8911:Csmd1 UTSW 8 16698003 missense probably damaging 0.99
R8966:Csmd1 UTSW 8 16200045 missense probably damaging 1.00
R8978:Csmd1 UTSW 8 15921056 missense probably benign 0.37
R8996:Csmd1 UTSW 8 15921105 missense possibly damaging 0.54
R9045:Csmd1 UTSW 8 16234074 missense probably damaging 0.99
R9084:Csmd1 UTSW 8 16088311 missense probably benign
R9124:Csmd1 UTSW 8 15984806 missense probably damaging 0.99
R9127:Csmd1 UTSW 8 16223272 missense probably benign 0.31
R9146:Csmd1 UTSW 8 15998832 missense probably benign 0.00
R9198:Csmd1 UTSW 8 15912430 missense probably damaging 1.00
R9285:Csmd1 UTSW 8 15906088 missense probably damaging 1.00
R9303:Csmd1 UTSW 8 15961532 missense probably benign 0.31
R9305:Csmd1 UTSW 8 15961532 missense probably benign 0.31
R9326:Csmd1 UTSW 8 15999803 missense probably benign 0.21
R9356:Csmd1 UTSW 8 16202055 missense probably damaging 1.00
R9385:Csmd1 UTSW 8 15984756 missense probably benign 0.19
R9444:Csmd1 UTSW 8 16158236 missense probably benign 0.30
R9476:Csmd1 UTSW 8 15931215 critical splice acceptor site probably null
R9506:Csmd1 UTSW 8 16200009 missense probably damaging 1.00
R9614:Csmd1 UTSW 8 16158225 missense probably benign 0.00
R9668:Csmd1 UTSW 8 16211758 missense probably benign 0.00
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Z1176:Csmd1 UTSW 8 15998814 missense probably damaging 1.00
Z1176:Csmd1 UTSW 8 16037198 missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 15984708 missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 16200019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCAGACAGATCATTGG -3'
(R):5'- TTCACAGTTATTTCCCTGCAAGG -3'

Sequencing Primer
(F):5'- GTGCCCAGACAGATCATTGGTAAAC -3'
(R):5'- CCTGCAAGGGGAAATTTTGAC -3'
Posted On 2015-10-08