Incidental Mutation 'R4633:Ces1c'
ID349354
Institutional Source Beutler Lab
Gene Symbol Ces1c
Ensembl Gene ENSMUSG00000057400
Gene Namecarboxylesterase 1C
SynonymsEs-4, Ces-N, Es1, Es-N, Ee-1, Es-1
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93099015-93131283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93118386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 275 (D275G)
Ref Sequence ENSEMBL: ENSMUSP00000034189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034189] [ENSMUST00000211843]
Predicted Effect probably benign
Transcript: ENSMUST00000034189
AA Change: D275G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034189
Gene: ENSMUSG00000057400
AA Change: D275G

DomainStartEndE-ValueType
Pfam:COesterase 1 534 4e-167 PFAM
Pfam:Abhydrolase_3 136 235 6.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131822
AA Change: *283W
Predicted Effect probably benign
Transcript: ENSMUST00000134161
AA Change: D129G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123146
Gene: ENSMUSG00000057400
AA Change: D129G

DomainStartEndE-ValueType
Pfam:Abhydrolase_3 1 140 3.2e-7 PFAM
Pfam:COesterase 1 177 4.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211843
AA Change: D129G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212091
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against nerve agents such as chlorpyrifos and chlorpyrifos oxon but increased sensitivity to soman coumarin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Ces1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ces1c APN 8 93106673 missense probably benign 0.02
IGL00558:Ces1c APN 8 93099271 missense probably benign 0.03
IGL00787:Ces1c APN 8 93120366 missense possibly damaging 0.90
IGL00851:Ces1c APN 8 93123117 missense probably benign 0.00
IGL01598:Ces1c APN 8 93118413 missense probably benign
IGL02616:Ces1c APN 8 93106615 missense probably benign 0.01
IGL03087:Ces1c APN 8 93118414 missense probably benign
IGL03203:Ces1c APN 8 93124588 missense probably damaging 1.00
R0119:Ces1c UTSW 8 93106717 unclassified probably benign
R0119:Ces1c UTSW 8 93107610 missense probably benign 0.00
R0255:Ces1c UTSW 8 93127524 missense probably benign
R0759:Ces1c UTSW 8 93130864 nonsense probably null
R1499:Ces1c UTSW 8 93127605 missense probably benign 0.01
R1926:Ces1c UTSW 8 93127604 missense possibly damaging 0.69
R2087:Ces1c UTSW 8 93107602 missense probably benign 0.00
R2142:Ces1c UTSW 8 93130840 missense probably benign
R2442:Ces1c UTSW 8 93123212 missense probably damaging 1.00
R2971:Ces1c UTSW 8 93104193 missense probably benign 0.01
R3079:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3080:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3609:Ces1c UTSW 8 93120332 missense probably damaging 1.00
R4131:Ces1c UTSW 8 93100684 missense probably damaging 1.00
R4988:Ces1c UTSW 8 93100708 missense probably damaging 1.00
R5081:Ces1c UTSW 8 93127569 missense probably damaging 1.00
R5497:Ces1c UTSW 8 93130715 missense possibly damaging 0.91
R5586:Ces1c UTSW 8 93127599 missense probably benign 0.00
R7013:Ces1c UTSW 8 93130764 missense probably damaging 1.00
R7137:Ces1c UTSW 8 93130842 missense probably benign 0.02
R7611:Ces1c UTSW 8 93124511 missense probably benign 0.00
R7882:Ces1c UTSW 8 93106603 missense probably benign
R8280:Ces1c UTSW 8 93099181 missense possibly damaging 0.53
R8705:Ces1c UTSW 8 93130890 missense probably benign
R8752:Ces1c UTSW 8 93120336 missense probably damaging 1.00
R8896:Ces1c UTSW 8 93106626 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTTGCAGTCAGGAAGTTG -3'
(R):5'- ACCTTATGAAATAAGATGTGAGCGC -3'

Sequencing Primer
(F):5'- GTCAGGAAGTTGACACTCTTTCCAAG -3'
(R):5'- TGTAAGTCCTGGGCTAGCCAAG -3'
Posted On2015-10-08