Incidental Mutation 'R4633:Pla2g15'
ID349355
Institutional Source Beutler Lab
Gene Symbol Pla2g15
Ensembl Gene ENSMUSG00000031903
Gene Namephospholipase A2, group XV
SynonymsLpla2, LLPL, Lypla3, C87498
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106150399-106164715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106160255 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 126 (F126S)
Ref Sequence ENSEMBL: ENSMUSP00000148565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034377] [ENSMUST00000212963]
Predicted Effect probably damaging
Transcript: ENSMUST00000034377
AA Change: F126S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034377
Gene: ENSMUSG00000031903
AA Change: F126S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LCAT 72 399 6.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212116
Predicted Effect probably damaging
Transcript: ENSMUST00000212963
AA Change: F126S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.4590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice do not develop atherosclerotic lesions even when fed an atherogenic diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Pla2g15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pla2g15 APN 8 106163116 missense probably benign 0.00
IGL02719:Pla2g15 APN 8 106160196 missense probably benign 0.01
IGL03065:Pla2g15 APN 8 106160219 missense probably benign 0.20
R0125:Pla2g15 UTSW 8 106163124 missense probably benign 0.00
R1691:Pla2g15 UTSW 8 106154949 missense possibly damaging 0.93
R1939:Pla2g15 UTSW 8 106163295 missense probably damaging 0.96
R3887:Pla2g15 UTSW 8 106161135 missense probably damaging 0.99
R4702:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4703:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4705:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4766:Pla2g15 UTSW 8 106163071 missense probably damaging 1.00
R4928:Pla2g15 UTSW 8 106163218 nonsense probably null
R5543:Pla2g15 UTSW 8 106161143 missense probably damaging 0.99
R6489:Pla2g15 UTSW 8 106163194 missense probably benign 0.10
R6802:Pla2g15 UTSW 8 106150581 missense probably damaging 0.99
R7381:Pla2g15 UTSW 8 106162944 missense probably benign 0.03
Z1177:Pla2g15 UTSW 8 106162987 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATCTGCACATGAGGCTGGAG -3'
(R):5'- TGTTAGCTACCTGCACCAC -3'

Sequencing Primer
(F):5'- CACATGAGGCTGGAGTGTGG -3'
(R):5'- CAGTGACGTCTGTCTCCCTGAAG -3'
Posted On2015-10-08