Mutagenetix > Incidental Mutation

Incidental Mutation 'R4633:Map1b'

349376

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

041898-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4633 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 99434942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 424 (V424M)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762] [ENSMUST00000223725]

AlphaFold

P14873

Predicted Effect

probably damaging
Transcript: ENSMUST00000064762
AA Change: V424M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: V424M

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

probably benign
Transcript: ENSMUST00000223725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.2720

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,387,529	L786Q	probably null	Het
Abcb6	A	T	1: 75,177,782		probably benign	Het
Alg10b	T	C	15: 90,228,294	V447A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
B4galt7	A	G	13: 55,608,750	H203R	probably damaging	Het
Ccdc130	T	C	8: 84,260,395	T158A	probably benign	Het
Cd44	T	G	2: 102,853,047	D214A	possibly damaging	Het
Ces1c	T	C	8: 93,118,386	D275G	probably benign	Het
Cnot11	G	T	1: 39,536,218	W127L	probably benign	Het
Csmd1	A	G	8: 16,002,620	I2168T	probably damaging	Het
Cyp3a59	T	C	5: 146,094,438	F137S	probably damaging	Het
Dst	T	A	1: 34,170,434	L1234Q	probably damaging	Het
Erbb2	T	A	11: 98,432,988	I676N	possibly damaging	Het
Erlin1	G	A	19: 44,040,765	R243C	probably damaging	Het
Fanci	T	C	7: 79,427,242	L576P	probably damaging	Het
Fzd1	A	T	5: 4,755,865	Y572*	probably null	Het
Glg1	C	T	8: 111,177,644		probably null	Het
Gm884	A	T	11: 103,619,131		probably benign	Het
Gpr139	A	T	7: 119,144,405	I319N	probably damaging	Het
Hectd4	C	A	5: 121,349,216	H3425N	probably benign	Het
Itga10	A	G	3: 96,647,704	D118G	possibly damaging	Het
Klra13-ps	T	G	6: 130,291,173		noncoding transcript	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Krt5	T	A	15: 101,711,607	D225V	probably damaging	Het
Krtap4-9	G	T	11: 99,785,554		probably benign	Het
Lama1	C	A	17: 67,798,584	A2029E	probably damaging	Het
Lrp2	T	A	2: 69,461,417	T3473S	probably benign	Het
Lrriq1	G	A	10: 103,200,563	R910*	probably null	Het
Mkl2	T	C	16: 13,379,873	I85T	possibly damaging	Het
Mylk2	T	C	2: 152,917,415	S369P	probably benign	Het
Myom3	T	G	4: 135,775,699	F362L	probably benign	Het
Nomo1	A	G	7: 46,050,260		probably benign	Het
Olfr1362	A	G	13: 21,611,228	V247A	probably damaging	Het
Olfr168	C	T	16: 19,530,284	G212D	possibly damaging	Het
Olfr59	T	G	11: 74,289,294	M216R	probably benign	Het
Olfr982	T	A	9: 40,074,334	V13E	probably damaging	Het
Parp4	C	T	14: 56,647,591	L1376F	unknown	Het
Phykpl	C	A	11: 51,593,608	A208E	probably damaging	Het
Pla2g15	T	C	8: 106,160,255	F126S	probably damaging	Het
Polq	T	G	16: 37,048,542	M479R	probably damaging	Het
Prpf4b	A	G	13: 34,900,442	T938A	probably damaging	Het
Psma1	A	G	7: 114,271,134	M63T	probably damaging	Het
Rbpms2	T	C	9: 65,651,636	S174P	probably benign	Het
Rcc1	G	T	4: 132,335,769	S162R	probably damaging	Het
Rev3l	T	G	10: 39,846,186	L2520R	probably damaging	Het
Rhobtb1	T	A	10: 69,249,613		probably null	Het
Rps19	G	T	7: 24,889,170		probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Selenof	C	T	3: 144,596,861	R116*	probably null	Het
Slc16a11	T	C	11: 70,216,379		probably null	Het
Stk3	A	G	15: 34,958,928	V296A	probably damaging	Het
Taar8b	C	A	10: 24,092,252	E15*	probably null	Het
Tas2r102	T	A	6: 132,762,679	N183K	possibly damaging	Het
Tcrg-C4	G	T	13: 19,352,287	V172F	probably benign	Het
Tet2	T	A	3: 133,485,549	E1041D	probably benign	Het
Tm9sf1	A	G	14: 55,641,203	V244A	probably damaging	Het
Trim24	T	A	6: 37,956,436	I650K	probably damaging	Het
Trim59	G	T	3: 69,037,414	Q198K	probably benign	Het
Ttc28	C	T	5: 111,224,001	T772I	probably damaging	Het
Tvp23a	C	T	16: 10,427,045	V146M	probably benign	Het
Usp17la	A	T	7: 104,860,221	D11V	possibly damaging	Het
Usp48	A	G	4: 137,634,900	K32R	probably damaging	Het
Uspl1	A	G	5: 149,214,392	K801E	probably damaging	Het
Utp20	T	C	10: 88,752,952	I2452V	probably benign	Het
Vps18	T	C	2: 119,293,276	L228P	probably damaging	Het
Zfp410	A	T	12: 84,325,736	D112V	probably damaging	Het
Zfp872	G	T	9: 22,197,194		probably null	Het
Zswim8	A	G	14: 20,718,823	E1110G	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGAACCCGAATGATTTTCTCAGC -3'
(R):5'- GGGTTGTGTTTCTCAACGTACC -3'

Sequencing Primer
(F):5'- CGAATGATTTTCTCAGCGGGGTTG -3'
(R):5'- GTTTCTCAACGTACCTGAAAACCTG -3'

Posted On

2015-10-08