Incidental Mutation 'R4633:Tvp23a'
ID349384
Institutional Source Beutler Lab
Gene Symbol Tvp23a
Ensembl Gene ENSMUSG00000050908
Gene Nametrans-golgi network vesicle protein 23A
Synonyms
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10420557-10447362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10427045 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 146 (V146M)
Ref Sequence ENSEMBL: ENSMUSP00000052922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023146] [ENSMUST00000051118] [ENSMUST00000128288]
Predicted Effect probably benign
Transcript: ENSMUST00000023146
SMART Domains Protein: ENSMUSP00000023146
Gene: ENSMUSG00000022503

DomainStartEndE-ValueType
AAA 54 210 6.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051118
AA Change: V146M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052922
Gene: ENSMUSG00000050908
AA Change: V146M

DomainStartEndE-ValueType
Pfam:DUF846 39 180 1.6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153027
Meta Mutation Damage Score 0.4299 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein associated with the Golgi apparatus, which plays a crucial role in intracellular vesicular transport. The encoded protein is likely associated with the late (trans) Golgi compartments, which are involved in the delivery of secretory and membrane proteins to the endosome, lysosome or the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Krtap4-9 G T 11: 99,785,554 probably benign Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Tvp23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1556:Tvp23a UTSW 16 10446998 missense probably damaging 1.00
R1691:Tvp23a UTSW 16 10428687 missense possibly damaging 0.59
R4384:Tvp23a UTSW 16 10428682 missense probably benign 0.06
R4721:Tvp23a UTSW 16 10427411 missense probably benign 0.16
R6843:Tvp23a UTSW 16 10447020 missense probably benign
R7076:Tvp23a UTSW 16 10428735 missense probably benign 0.22
R7619:Tvp23a UTSW 16 10428738 missense probably damaging 1.00
R7774:Tvp23a UTSW 16 10427381 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGACATTGTGATATAACTCCAC -3'
(R):5'- ACAGGTTCCCAAGTTGTGTG -3'

Sequencing Primer
(F):5'- GTGATATAACTCCACAAGATTGACAG -3'
(R):5'- GTGGTGGTAATGCACACCTTTAATC -3'
Posted On2015-10-08