Mutagenetix > Incidental Mutation

Incidental Mutation 'R4633:Abca3'

349388

Institutional Source

Beutler Lab

Gene Symbol

Abca3

Ensembl Gene

ENSMUSG00000024130

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 3

Synonyms

ABC-C, 1810036E22Rik, Abc3

MMRRC Submission

041898-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4633 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24351950-24410201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24387529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 786 (L786Q)

Ref Sequence

ENSEMBL: ENSMUSP00000078544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]

AlphaFold

Q8R420

Predicted Effect

probably null
Transcript: ENSMUST00000039013
AA Change: L786Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: L786Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	2.1e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	1.8e-35	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079594
AA Change: L786Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: L786Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	22	469	2.6e-28	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	5.5e-39	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000117337
AA Change: L786Q

SMART Domains

Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: L786Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	1.3e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	761	1068	8.8e-29	PFAM
AAA	1153	1337	1.64e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148557

Meta Mutation Damage Score

0.2266

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb6	A	T	1: 75,177,782		probably benign	Het
Alg10b	T	C	15: 90,228,294	V447A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
B4galt7	A	G	13: 55,608,750	H203R	probably damaging	Het
Ccdc130	T	C	8: 84,260,395	T158A	probably benign	Het
Cd44	T	G	2: 102,853,047	D214A	possibly damaging	Het
Ces1c	T	C	8: 93,118,386	D275G	probably benign	Het
Cnot11	G	T	1: 39,536,218	W127L	probably benign	Het
Csmd1	A	G	8: 16,002,620	I2168T	probably damaging	Het
Cyp3a59	T	C	5: 146,094,438	F137S	probably damaging	Het
Dst	T	A	1: 34,170,434	L1234Q	probably damaging	Het
Erbb2	T	A	11: 98,432,988	I676N	possibly damaging	Het
Erlin1	G	A	19: 44,040,765	R243C	probably damaging	Het
Fanci	T	C	7: 79,427,242	L576P	probably damaging	Het
Fzd1	A	T	5: 4,755,865	Y572*	probably null	Het
Glg1	C	T	8: 111,177,644		probably null	Het
Gm884	A	T	11: 103,619,131		probably benign	Het
Gpr139	A	T	7: 119,144,405	I319N	probably damaging	Het
Hectd4	C	A	5: 121,349,216	H3425N	probably benign	Het
Itga10	A	G	3: 96,647,704	D118G	possibly damaging	Het
Klra13-ps	T	G	6: 130,291,173		noncoding transcript	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Krt5	T	A	15: 101,711,607	D225V	probably damaging	Het
Krtap4-9	G	T	11: 99,785,554		probably benign	Het
Lama1	C	A	17: 67,798,584	A2029E	probably damaging	Het
Lrp2	T	A	2: 69,461,417	T3473S	probably benign	Het
Lrriq1	G	A	10: 103,200,563	R910*	probably null	Het
Map1b	C	T	13: 99,434,942	V424M	probably damaging	Het
Mkl2	T	C	16: 13,379,873	I85T	possibly damaging	Het
Mylk2	T	C	2: 152,917,415	S369P	probably benign	Het
Myom3	T	G	4: 135,775,699	F362L	probably benign	Het
Nomo1	A	G	7: 46,050,260		probably benign	Het
Olfr1362	A	G	13: 21,611,228	V247A	probably damaging	Het
Olfr168	C	T	16: 19,530,284	G212D	possibly damaging	Het
Olfr59	T	G	11: 74,289,294	M216R	probably benign	Het
Olfr982	T	A	9: 40,074,334	V13E	probably damaging	Het
Parp4	C	T	14: 56,647,591	L1376F	unknown	Het
Phykpl	C	A	11: 51,593,608	A208E	probably damaging	Het
Pla2g15	T	C	8: 106,160,255	F126S	probably damaging	Het
Polq	T	G	16: 37,048,542	M479R	probably damaging	Het
Prpf4b	A	G	13: 34,900,442	T938A	probably damaging	Het
Psma1	A	G	7: 114,271,134	M63T	probably damaging	Het
Rbpms2	T	C	9: 65,651,636	S174P	probably benign	Het
Rcc1	G	T	4: 132,335,769	S162R	probably damaging	Het
Rev3l	T	G	10: 39,846,186	L2520R	probably damaging	Het
Rhobtb1	T	A	10: 69,249,613		probably null	Het
Rps19	G	T	7: 24,889,170		probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Selenof	C	T	3: 144,596,861	R116*	probably null	Het
Slc16a11	T	C	11: 70,216,379		probably null	Het
Stk3	A	G	15: 34,958,928	V296A	probably damaging	Het
Taar8b	C	A	10: 24,092,252	E15*	probably null	Het
Tas2r102	T	A	6: 132,762,679	N183K	possibly damaging	Het
Tcrg-C4	G	T	13: 19,352,287	V172F	probably benign	Het
Tet2	T	A	3: 133,485,549	E1041D	probably benign	Het
Tm9sf1	A	G	14: 55,641,203	V244A	probably damaging	Het
Trim24	T	A	6: 37,956,436	I650K	probably damaging	Het
Trim59	G	T	3: 69,037,414	Q198K	probably benign	Het
Ttc28	C	T	5: 111,224,001	T772I	probably damaging	Het
Tvp23a	C	T	16: 10,427,045	V146M	probably benign	Het
Usp17la	A	T	7: 104,860,221	D11V	possibly damaging	Het
Usp48	A	G	4: 137,634,900	K32R	probably damaging	Het
Uspl1	A	G	5: 149,214,392	K801E	probably damaging	Het
Utp20	T	C	10: 88,752,952	I2452V	probably benign	Het
Vps18	T	C	2: 119,293,276	L228P	probably damaging	Het
Zfp410	A	T	12: 84,325,736	D112V	probably damaging	Het
Zfp872	G	T	9: 22,197,194		probably null	Het
Zswim8	A	G	14: 20,718,823	E1110G	probably damaging	Het

Other mutations in Abca3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Abca3	APN	17	24374246	missense	probably damaging	1.00
IGL01538:Abca3	APN	17	24376473	missense	possibly damaging	0.64
IGL01633:Abca3	APN	17	24397353	nonsense	probably null
IGL01837:Abca3	APN	17	24408697	missense	probably damaging	1.00
IGL01986:Abca3	APN	17	24408114	missense	probably damaging	1.00
IGL02049:Abca3	APN	17	24376730	nonsense	probably null
IGL02186:Abca3	APN	17	24377740	missense	possibly damaging	0.95
IGL02794:Abca3	APN	17	24402411	missense	probably benign	0.05
IGL02962:Abca3	APN	17	24400409	missense	probably damaging	1.00
IGL02963:Abca3	APN	17	24384529	missense	probably damaging	1.00
IGL03118:Abca3	APN	17	24400450	missense	probably benign	0.17
IGL03144:Abca3	APN	17	24381964	missense	probably benign	0.37
R0028:Abca3	UTSW	17	24377724	missense	probably benign	0.39
R0278:Abca3	UTSW	17	24381920	missense	probably benign	0.09
R0570:Abca3	UTSW	17	24374399	missense	probably benign
R0825:Abca3	UTSW	17	24400577	missense	probably damaging	1.00
R1164:Abca3	UTSW	17	24402331	missense	probably damaging	1.00
R1348:Abca3	UTSW	17	24374238	splice site	probably null
R1557:Abca3	UTSW	17	24399980	missense	possibly damaging	0.46
R1661:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1665:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1754:Abca3	UTSW	17	24377779	missense	probably benign	0.00
R1828:Abca3	UTSW	17	24366197	missense	probably benign	0.34
R1834:Abca3	UTSW	17	24376692	missense	probably benign	0.00
R1996:Abca3	UTSW	17	24387532	missense	probably damaging	1.00
R2032:Abca3	UTSW	17	24366082	splice site	probably benign
R2100:Abca3	UTSW	17	24408209	missense	probably damaging	0.99
R2154:Abca3	UTSW	17	24377719	missense	probably damaging	1.00
R2240:Abca3	UTSW	17	24376443	missense	probably damaging	0.98
R2281:Abca3	UTSW	17	24376726	missense	possibly damaging	0.88
R2994:Abca3	UTSW	17	24384564	missense	probably damaging	1.00
R4091:Abca3	UTSW	17	24397482	missense	probably damaging	1.00
R4294:Abca3	UTSW	17	24400569	missense	possibly damaging	0.96
R4496:Abca3	UTSW	17	24383973	missense	possibly damaging	0.93
R4866:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5022:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5023:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5072:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5073:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5074:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5123:Abca3	UTSW	17	24384460	missense	possibly damaging	0.95
R5157:Abca3	UTSW	17	24408122	missense	probably damaging	1.00
R5183:Abca3	UTSW	17	24374453	missense	probably benign	0.39
R5269:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R5566:Abca3	UTSW	17	24383927	missense	probably benign
R5579:Abca3	UTSW	17	24376729	missense	probably damaging	0.97
R5620:Abca3	UTSW	17	24396470	missense	probably benign	0.05
R5755:Abca3	UTSW	17	24398454	missense	probably damaging	1.00
R5954:Abca3	UTSW	17	24397416	missense	probably benign	0.00
R6041:Abca3	UTSW	17	24376380	missense	probably damaging	0.99
R6187:Abca3	UTSW	17	24408167	missense	possibly damaging	0.88
R6253:Abca3	UTSW	17	24397552	missense	probably benign	0.01
R6375:Abca3	UTSW	17	24387562	missense	possibly damaging	0.96
R6487:Abca3	UTSW	17	24397472	missense	possibly damaging	0.81
R6616:Abca3	UTSW	17	24384535	missense	probably damaging	1.00
R6632:Abca3	UTSW	17	24384470	missense	probably benign
R6781:Abca3	UTSW	17	24374406	missense	possibly damaging	0.95
R6918:Abca3	UTSW	17	24408658	missense	probably damaging	1.00
R6962:Abca3	UTSW	17	24364726	missense	probably benign	0.39
R7163:Abca3	UTSW	17	24364942	missense	probably benign
R7199:Abca3	UTSW	17	24377707	missense	probably damaging	1.00
R7287:Abca3	UTSW	17	24385887	missense	possibly damaging	0.91
R7303:Abca3	UTSW	17	24398521	missense	possibly damaging	0.83
R7338:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R7430:Abca3	UTSW	17	24364958	critical splice donor site	probably null
R7437:Abca3	UTSW	17	24400498	missense	probably damaging	0.99
R7776:Abca3	UTSW	17	24386276	missense	possibly damaging	0.77
R7805:Abca3	UTSW	17	24405154	critical splice donor site	probably null
R7811:Abca3	UTSW	17	24397388	missense	probably benign	0.00
R7848:Abca3	UTSW	17	24384532	missense	probably damaging	1.00
R7859:Abca3	UTSW	17	24384526	missense	probably damaging	1.00
R7877:Abca3	UTSW	17	24384023	nonsense	probably null
R7893:Abca3	UTSW	17	24385466	missense	probably damaging	1.00
R7910:Abca3	UTSW	17	24385853	missense	probably benign	0.09
R7911:Abca3	UTSW	17	24398504	missense	probably damaging	1.00
R7964:Abca3	UTSW	17	24402436	missense	probably benign	0.26
R8016:Abca3	UTSW	17	24364952	missense	probably benign	0.06
R8028:Abca3	UTSW	17	24407697	missense	probably benign	0.02
R8150:Abca3	UTSW	17	24396548	missense	probably benign	0.08
R8298:Abca3	UTSW	17	24385401	missense	probably damaging	1.00
R8444:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R8505:Abca3	UTSW	17	24374497	missense	probably damaging	0.97
R8547:Abca3	UTSW	17	24397500	missense	probably benign	0.00
R8699:Abca3	UTSW	17	24408225	missense	probably benign	0.01
R8903:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R9046:Abca3	UTSW	17	24398503	missense	probably damaging	1.00
R9136:Abca3	UTSW	17	24377833	missense	probably benign	0.01
R9236:Abca3	UTSW	17	24407738	missense	probably benign	0.16
R9331:Abca3	UTSW	17	24397350	missense	probably benign	0.00
R9585:Abca3	UTSW	17	24400512	missense	probably benign	0.12
R9602:Abca3	UTSW	17	24398404	missense	probably benign	0.35
R9714:Abca3	UTSW	17	24376728	missense	probably benign	0.44
X0018:Abca3	UTSW	17	24396480	missense	possibly damaging	0.63
Z1177:Abca3	UTSW	17	24408236	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CACCCATTGTGCAGATACTTCC -3'
(R):5'- TTTGTCCCACAAGCCCAGTTG -3'

Sequencing Primer
(F):5'- GTGCAGATACTTCCCCGTG -3'
(R):5'- AAGCCCAGTTGGTGCTTAAC -3'

Posted On

2015-10-08