Mutagenetix > Incidental Mutation

Incidental Mutation 'R4634:Trip11'

349414

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik

MMRRC Submission

042009-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101800304-101879463 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101803875 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1669 (T1669K)

Ref Sequence

ENSEMBL: ENSMUSP00000134976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]

AlphaFold

E9Q512

Predicted Effect

probably damaging
Transcript: ENSMUST00000021605
AA Change: T1954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: T1954K

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177183
AA Change: T1669K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: T1669K

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Meta Mutation Damage Score

0.2206

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	G	15: 74,456,278 (GRCm39)		probably benign	Het
Atm	T	C	9: 53,443,033 (GRCm39)	T77A	probably benign	Het
Brd8	T	C	18: 34,741,537 (GRCm39)	M311V	possibly damaging	Het
Cand2	T	A	6: 115,774,948 (GRCm39)	I1052N	probably damaging	Het
Ccdc121	G	A	5: 31,645,435 (GRCm39)	R396Q	probably benign	Het
Ceacam16	T	A	7: 19,592,531 (GRCm39)	M126L	probably benign	Het
Chd3	TGCTGCCGCTGCCGC	TGCTGCCGCTGCCGCTGCCGC	11: 69,253,013 (GRCm39)		probably benign	Het
Cln8	C	T	8: 14,944,842 (GRCm39)	T52I	probably damaging	Het
Cops2	C	A	2: 125,682,400 (GRCm39)	D194Y	probably damaging	Het
Csf1	C	T	3: 107,656,483 (GRCm39)	V71M	probably damaging	Het
Dip2b	T	C	15: 100,058,372 (GRCm39)	F183S	probably damaging	Het
Ears2	T	A	7: 121,643,832 (GRCm39)	K375N	probably benign	Het
Fbn1	C	A	2: 125,185,981 (GRCm39)	G1596C	probably damaging	Het
Fscn2	A	T	11: 120,258,546 (GRCm39)	D390V	possibly damaging	Het
Gm42669	A	T	5: 107,656,079 (GRCm39)	I781F	possibly damaging	Het
Gprin1	G	T	13: 54,885,871 (GRCm39)	P801Q	probably damaging	Het
Hira	C	A	16: 18,765,150 (GRCm39)	S609R	probably damaging	Het
Htt	G	T	5: 35,033,292 (GRCm39)	K1853N	probably benign	Het
Kif2c	T	C	4: 117,035,437 (GRCm39)	I4V	probably benign	Het
Marveld2	A	G	13: 100,748,447 (GRCm39)	Y211H	probably damaging	Het
Myd88	G	A	9: 119,167,175 (GRCm39)		probably null	Het
Nup153	A	T	13: 46,840,706 (GRCm39)	N967K	possibly damaging	Het
Or4a76	A	C	2: 89,460,516 (GRCm39)	I242S	possibly damaging	Het
Peg10	GC	GCTCC	6: 4,756,452 (GRCm39)		probably benign	Het
Rabepk	A	G	2: 34,670,752 (GRCm39)	M228T	probably damaging	Het
Rcn3	T	A	7: 44,738,092 (GRCm39)	D92V	probably damaging	Het
Sec1	T	A	7: 45,328,297 (GRCm39)	Y250F	probably damaging	Het
Slc39a4	T	C	15: 76,498,693 (GRCm39)	T334A	probably benign	Het
Ttbk2	A	G	2: 120,570,673 (GRCm39)	L1091P	probably damaging	Het
Vmn1r231	A	G	17: 21,110,660 (GRCm39)	V85A	possibly damaging	Het
Zfp280b	T	C	10: 75,874,663 (GRCm39)	C181R	probably benign	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101,852,406 (GRCm39)	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101,851,570 (GRCm39)	nonsense	probably null
IGL00972:Trip11	APN	12	101,860,596 (GRCm39)	missense	probably null	1.00
IGL01476:Trip11	APN	12	101,865,170 (GRCm39)	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101,849,604 (GRCm39)	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101,845,121 (GRCm39)	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101,850,890 (GRCm39)	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101,838,090 (GRCm39)	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101,850,747 (GRCm39)	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101,851,935 (GRCm39)	missense	probably benign
IGL01924:Trip11	APN	12	101,853,143 (GRCm39)	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101,850,572 (GRCm39)	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101,861,942 (GRCm39)	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101,859,780 (GRCm39)	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101,849,649 (GRCm39)	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101,850,260 (GRCm39)	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101,852,284 (GRCm39)	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101,853,097 (GRCm39)	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101,850,195 (GRCm39)	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101,865,184 (GRCm39)	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101,849,677 (GRCm39)	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101,851,278 (GRCm39)	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101,860,580 (GRCm39)	splice site	probably null
R0027:Trip11	UTSW	12	101,851,428 (GRCm39)	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101,851,016 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101,851,931 (GRCm39)	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101,850,777 (GRCm39)	nonsense	probably null
R0573:Trip11	UTSW	12	101,853,119 (GRCm39)	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101,852,235 (GRCm39)	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101,852,419 (GRCm39)	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101,879,026 (GRCm39)	missense	unknown
R1647:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1648:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1856:Trip11	UTSW	12	101,849,592 (GRCm39)	nonsense	probably null
R2013:Trip11	UTSW	12	101,803,981 (GRCm39)	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101,851,619 (GRCm39)	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101,865,236 (GRCm39)	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101,845,086 (GRCm39)	makesense	probably null
R2513:Trip11	UTSW	12	101,803,986 (GRCm39)	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101,859,953 (GRCm39)	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101,860,581 (GRCm39)	nonsense	probably null
R4124:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4126:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4128:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4175:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4176:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4181:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101,852,127 (GRCm39)	nonsense	probably null
R4302:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101,853,198 (GRCm39)	missense	probably benign
R4342:Trip11	UTSW	12	101,850,575 (GRCm39)	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101,852,499 (GRCm39)	nonsense	probably null
R4586:Trip11	UTSW	12	101,849,600 (GRCm39)	missense	possibly damaging	0.55
R4696:Trip11	UTSW	12	101,851,549 (GRCm39)	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101,851,705 (GRCm39)	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101,853,065 (GRCm39)	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101,851,169 (GRCm39)	nonsense	probably null
R5017:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101,851,179 (GRCm39)	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101,851,860 (GRCm39)	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101,851,386 (GRCm39)	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5755:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5890:Trip11	UTSW	12	101,852,231 (GRCm39)	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101,849,738 (GRCm39)	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101,856,001 (GRCm39)	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101,865,154 (GRCm39)	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101,856,859 (GRCm39)	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101,851,837 (GRCm39)	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101,851,790 (GRCm39)	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101,803,886 (GRCm39)	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101,859,942 (GRCm39)	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101,852,126 (GRCm39)	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101,850,329 (GRCm39)	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101,850,611 (GRCm39)	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101,851,457 (GRCm39)	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101,850,278 (GRCm39)	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101,851,639 (GRCm39)	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101,851,694 (GRCm39)	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101,853,233 (GRCm39)	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101,811,114 (GRCm39)	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101,849,796 (GRCm39)	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101,844,403 (GRCm39)	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101,803,924 (GRCm39)	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101,849,741 (GRCm39)	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101,860,643 (GRCm39)	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101,811,160 (GRCm39)	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101,879,063 (GRCm39)	missense	unknown
R8690:Trip11	UTSW	12	101,839,656 (GRCm39)	missense	possibly damaging	0.76
R8879:Trip11	UTSW	12	101,828,857 (GRCm39)	missense	probably benign	0.00
R8964:Trip11	UTSW	12	101,811,315 (GRCm39)	critical splice donor site	probably null
R9005:Trip11	UTSW	12	101,845,131 (GRCm39)	missense	probably benign	0.02
R9013:Trip11	UTSW	12	101,851,377 (GRCm39)	missense	probably damaging	0.99
R9020:Trip11	UTSW	12	101,850,770 (GRCm39)	missense	possibly damaging	0.91
R9041:Trip11	UTSW	12	101,845,127 (GRCm39)	missense	probably benign	0.06
R9234:Trip11	UTSW	12	101,811,990 (GRCm39)	critical splice donor site	probably null
R9447:Trip11	UTSW	12	101,850,148 (GRCm39)	missense	probably damaging	1.00
R9631:Trip11	UTSW	12	101,859,807 (GRCm39)	missense	probably benign
R9641:Trip11	UTSW	12	101,859,957 (GRCm39)	nonsense	probably null
R9691:Trip11	UTSW	12	101,850,123 (GRCm39)	missense	probably benign	0.00
R9751:Trip11	UTSW	12	101,850,765 (GRCm39)	missense	possibly damaging	0.54
X0020:Trip11	UTSW	12	101,852,172 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AATGACTCTTTCTAGAAGGCCAC -3'
(R):5'- AAACTAGTACTGTGTTCAGAGGGTTC -3'

Sequencing Primer
(F):5'- GACTCTTTCTAGAAGGCCACTTTGTG -3'
(R):5'- TGTTCAGAGGGTTCTTTCATTAAATC -3'

Posted On

2015-10-08