Mutagenetix > Incidental Mutation

Incidental Mutation 'R4634:Adgrb1'

349417

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

B830018M07Rik, Bai1

MMRRC Submission

042009-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4634 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

74388045-74461314 bp(+) (GRCm39)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

A to G at 74456278 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably benign
Transcript: ENSMUST00000042035

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170845

SMART Domains

Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185682

SMART Domains

Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186095

Predicted Effect

probably benign
Transcript: ENSMUST00000186360

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187639

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230935

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atm	T	C	9: 53,443,033 (GRCm39)	T77A	probably benign	Het
Brd8	T	C	18: 34,741,537 (GRCm39)	M311V	possibly damaging	Het
Cand2	T	A	6: 115,774,948 (GRCm39)	I1052N	probably damaging	Het
Ccdc121	G	A	5: 31,645,435 (GRCm39)	R396Q	probably benign	Het
Ceacam16	T	A	7: 19,592,531 (GRCm39)	M126L	probably benign	Het
Chd3	TGCTGCCGCTGCCGC	TGCTGCCGCTGCCGCTGCCGC	11: 69,253,013 (GRCm39)		probably benign	Het
Cln8	C	T	8: 14,944,842 (GRCm39)	T52I	probably damaging	Het
Cops2	C	A	2: 125,682,400 (GRCm39)	D194Y	probably damaging	Het
Csf1	C	T	3: 107,656,483 (GRCm39)	V71M	probably damaging	Het
Dip2b	T	C	15: 100,058,372 (GRCm39)	F183S	probably damaging	Het
Ears2	T	A	7: 121,643,832 (GRCm39)	K375N	probably benign	Het
Fbn1	C	A	2: 125,185,981 (GRCm39)	G1596C	probably damaging	Het
Fscn2	A	T	11: 120,258,546 (GRCm39)	D390V	possibly damaging	Het
Gm42669	A	T	5: 107,656,079 (GRCm39)	I781F	possibly damaging	Het
Gprin1	G	T	13: 54,885,871 (GRCm39)	P801Q	probably damaging	Het
Hira	C	A	16: 18,765,150 (GRCm39)	S609R	probably damaging	Het
Htt	G	T	5: 35,033,292 (GRCm39)	K1853N	probably benign	Het
Kif2c	T	C	4: 117,035,437 (GRCm39)	I4V	probably benign	Het
Marveld2	A	G	13: 100,748,447 (GRCm39)	Y211H	probably damaging	Het
Myd88	G	A	9: 119,167,175 (GRCm39)		probably null	Het
Nup153	A	T	13: 46,840,706 (GRCm39)	N967K	possibly damaging	Het
Or4a76	A	C	2: 89,460,516 (GRCm39)	I242S	possibly damaging	Het
Peg10	GC	GCTCC	6: 4,756,452 (GRCm39)		probably benign	Het
Rabepk	A	G	2: 34,670,752 (GRCm39)	M228T	probably damaging	Het
Rcn3	T	A	7: 44,738,092 (GRCm39)	D92V	probably damaging	Het
Sec1	T	A	7: 45,328,297 (GRCm39)	Y250F	probably damaging	Het
Slc39a4	T	C	15: 76,498,693 (GRCm39)	T334A	probably benign	Het
Trip11	G	T	12: 101,803,875 (GRCm39)	T1669K	probably damaging	Het
Ttbk2	A	G	2: 120,570,673 (GRCm39)	L1091P	probably damaging	Het
Vmn1r231	A	G	17: 21,110,660 (GRCm39)	V85A	possibly damaging	Het
Zfp280b	T	C	10: 75,874,663 (GRCm39)	C181R	probably benign	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74,458,684 (GRCm39)	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74,420,206 (GRCm39)	splice site	probably benign
IGL01874:Adgrb1	APN	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74,413,424 (GRCm39)	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74,401,631 (GRCm39)	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74,412,326 (GRCm39)	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74,445,961 (GRCm39)	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74,458,654 (GRCm39)	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74,460,143 (GRCm39)	splice site	probably benign
IGL02678:Adgrb1	APN	15	74,410,177 (GRCm39)	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74,419,471 (GRCm39)	missense	probably damaging	0.98
Bunting	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74,413,508 (GRCm39)	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74,444,005 (GRCm39)	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74,458,656 (GRCm39)	missense	probably benign
R0267:Adgrb1	UTSW	15	74,401,238 (GRCm39)	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74,458,998 (GRCm39)	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74,415,198 (GRCm39)	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74,413,408 (GRCm39)	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74,412,741 (GRCm39)	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74,420,398 (GRCm39)	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74,419,534 (GRCm39)	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74,421,888 (GRCm39)	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74,459,956 (GRCm39)	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74,401,192 (GRCm39)	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74,413,676 (GRCm39)	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74,401,389 (GRCm39)	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74,452,435 (GRCm39)	nonsense	probably null
R1895:Adgrb1	UTSW	15	74,412,314 (GRCm39)	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74,411,726 (GRCm39)	splice site	probably benign
R2114:Adgrb1	UTSW	15	74,412,411 (GRCm39)	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74,401,757 (GRCm39)	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74,419,553 (GRCm39)	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74,416,864 (GRCm39)	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74,460,157 (GRCm39)	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74,454,792 (GRCm39)	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74,415,511 (GRCm39)	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74,449,302 (GRCm39)	unclassified	probably benign
R4683:Adgrb1	UTSW	15	74,459,963 (GRCm39)	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74,401,328 (GRCm39)	nonsense	probably null
R4760:Adgrb1	UTSW	15	74,443,312 (GRCm39)	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74,459,978 (GRCm39)	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74,458,871 (GRCm39)	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74,444,011 (GRCm39)	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74,401,664 (GRCm39)	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74,449,348 (GRCm39)	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74,421,876 (GRCm39)	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74,410,219 (GRCm39)	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74,412,308 (GRCm39)	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74,459,992 (GRCm39)	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74,401,210 (GRCm39)	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74,421,873 (GRCm39)	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74,401,750 (GRCm39)	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74,445,959 (GRCm39)	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74,441,730 (GRCm39)	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74,441,797 (GRCm39)	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74,441,733 (GRCm39)	missense	probably benign
R7283:Adgrb1	UTSW	15	74,452,512 (GRCm39)	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74,420,418 (GRCm39)	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74,415,487 (GRCm39)	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74,416,849 (GRCm39)	missense	probably damaging	0.98
R8152:Adgrb1	UTSW	15	74,413,460 (GRCm39)	missense	probably benign	0.00
R8198:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74,420,153 (GRCm39)	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74,447,700 (GRCm39)	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74,415,357 (GRCm39)	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74,415,507 (GRCm39)	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74,441,748 (GRCm39)	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74,415,189 (GRCm39)	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74,420,475 (GRCm39)	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74,435,807 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74,419,532 (GRCm39)	missense	probably damaging	0.99
Z1177:Adgrb1	UTSW	15	74,413,525 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCCATAGACTAATAATGTGGG -3'
(R):5'- ACAACAGCTTTCTGGGGCTC -3'

Sequencing Primer
(F):5'- CCCATAGACTAATAATGTGGGCTGGG -3'
(R):5'- TTCTGGGGCTCCCTCAG -3'

Posted On

2015-10-08