Incidental Mutation 'R4635:Amer3'
ID349423
Institutional Source Beutler Lab
Gene Symbol Amer3
Ensembl Gene ENSMUSG00000045174
Gene NameAPC membrane recruitment 3
SynonymsFam123c, 9430069J07Rik
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34579657-34590944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34587877 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 399 (T399K)
Ref Sequence ENSEMBL: ENSMUSP00000054748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052670]
Predicted Effect probably damaging
Transcript: ENSMUST00000052670
AA Change: T399K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054748
Gene: ENSMUSG00000045174
AA Change: T399K

DomainStartEndE-ValueType
Pfam:WTX 138 444 1.6e-37 PFAM
low complexity region 506 523 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Amer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Amer3 APN 1 34588527 missense probably benign 0.26
IGL01062:Amer3 APN 1 34586739 missense probably damaging 0.96
IGL01501:Amer3 APN 1 34588317 missense probably benign
IGL02642:Amer3 APN 1 34586680 utr 5 prime probably benign
IGL02861:Amer3 APN 1 34588125 missense probably damaging 1.00
IGL02953:Amer3 APN 1 34587796 missense probably damaging 0.98
R0183:Amer3 UTSW 1 34587757 missense probably damaging 0.99
R0335:Amer3 UTSW 1 34579300 unclassified probably benign
R0639:Amer3 UTSW 1 34587821 nonsense probably null
R1391:Amer3 UTSW 1 34588389 missense probably benign 0.09
R1514:Amer3 UTSW 1 34579327 unclassified probably benign
R1615:Amer3 UTSW 1 34588171 missense probably damaging 0.99
R2014:Amer3 UTSW 1 34579444 unclassified probably benign
R2104:Amer3 UTSW 1 34588678 missense probably benign 0.00
R3080:Amer3 UTSW 1 34588422 missense probably benign 0.23
R4508:Amer3 UTSW 1 34588299 missense probably benign 0.00
R4978:Amer3 UTSW 1 34579300 unclassified probably benign
R4990:Amer3 UTSW 1 34588741 missense probably benign 0.17
R4991:Amer3 UTSW 1 34588741 missense probably benign 0.17
R5112:Amer3 UTSW 1 34587076 missense possibly damaging 0.94
R5645:Amer3 UTSW 1 34588381 missense possibly damaging 0.76
R6483:Amer3 UTSW 1 34587690 missense probably damaging 0.97
R6769:Amer3 UTSW 1 34588249 missense possibly damaging 0.93
R7097:Amer3 UTSW 1 34588788 missense probably benign
R7246:Amer3 UTSW 1 34586728 missense possibly damaging 0.82
R7347:Amer3 UTSW 1 34587902 missense probably damaging 1.00
R7466:Amer3 UTSW 1 34587993 missense probably damaging 1.00
R7719:Amer3 UTSW 1 34589002 missense possibly damaging 0.55
R8158:Amer3 UTSW 1 34587660 missense possibly damaging 0.68
RF016:Amer3 UTSW 1 34587120 missense probably damaging 1.00
X0020:Amer3 UTSW 1 34588836 missense probably benign 0.00
Z1176:Amer3 UTSW 1 34589013 missense probably benign
Z1177:Amer3 UTSW 1 34587196 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGAACTACCCCTGTTCC -3'
(R):5'- AAACCCTGGCTGAGCAAGTC -3'

Sequencing Primer
(F):5'- AACTACCCCTGTTCCCTTGCAG -3'
(R):5'- TGAGCAAGTCAGGGCCTG -3'
Posted On2015-10-08