Incidental Mutation 'R4635:Hao1'
ID349428
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission 041899-MU
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134523152 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 185 (N185I)
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028704
AA Change: N185I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: N185I

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Meta Mutation Damage Score 0.6238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R7920:Hao1 UTSW 2 134548252 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCAAATGATAGGGCATCTGCC -3'
(R):5'- ACTGGATGGTCACAGTTAGAAC -3'

Sequencing Primer
(F):5'- TGATTGTAAAATCAGTGTGCAGC -3'
(R):5'- GGATGGTCACAGTTAGAACATACTTC -3'
Posted On2015-10-08