Incidental Mutation 'R4635:4930548H24Rik'
ID349433
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31488091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 396 (R396Q)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020]
Predicted Effect probably benign
Transcript: ENSMUST00000031020
AA Change: R396Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: R396Q

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202605
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R1366:4930548H24Rik UTSW 5 31487517 missense probably benign 0.07
R2050:4930548H24Rik UTSW 5 31486058 missense possibly damaging 0.68
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4634:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4637:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
RF006:4930548H24Rik UTSW 5 31487550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGCAGGAGACCATAAC -3'
(R):5'- GGGGCCTAGTAGTTCTGAATC -3'

Sequencing Primer
(F):5'- GGAGACCATAACACCCCAGAGG -3'
(R):5'- GTAGTTCTGAATCTTCATTTTCTGGC -3'
Posted On2015-10-08