Incidental Mutation 'R4635:Chchd6'
ID 349435
Institutional Source Beutler Lab
Gene Symbol Chchd6
Ensembl Gene ENSMUSG00000030086
Gene Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms 1700021B03Rik, 0710001P09Rik
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4635 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 89383146-89595652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89467466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 178 (E178G)
Ref Sequence ENSEMBL: ENSMUSP00000032172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032172] [ENSMUST00000113550]
AlphaFold Q91VN4
Predicted Effect probably damaging
Transcript: ENSMUST00000032172
AA Change: E178G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032172
Gene: ENSMUSG00000030086
AA Change: E178G

DomainStartEndE-ValueType
Pfam:DUF737 16 227 1.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113550
SMART Domains Protein: ENSMUSP00000109179
Gene: ENSMUSG00000030086

DomainStartEndE-ValueType
Pfam:DUF737 16 179 4.8e-47 PFAM
Pfam:DUF737 173 199 9.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204970
Meta Mutation Damage Score 0.2920 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Chchd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Chchd6 APN 6 89569417 splice site probably null
IGL02340:Chchd6 APN 6 89419780 missense probably damaging 0.99
IGL02490:Chchd6 APN 6 89384674 missense possibly damaging 0.90
R0557:Chchd6 UTSW 6 89574587 missense probably damaging 1.00
R1170:Chchd6 UTSW 6 89384687 missense probably damaging 1.00
R1341:Chchd6 UTSW 6 89384641 missense probably benign 0.00
R1619:Chchd6 UTSW 6 89419754 missense possibly damaging 0.95
R1757:Chchd6 UTSW 6 89384644 missense probably damaging 1.00
R3886:Chchd6 UTSW 6 89467451 missense probably damaging 1.00
R4627:Chchd6 UTSW 6 89384660 missense probably damaging 1.00
R5518:Chchd6 UTSW 6 89567585 critical splice donor site probably null
R6732:Chchd6 UTSW 6 89574454 missense probably benign 0.03
R6869:Chchd6 UTSW 6 89595496 missense probably damaging 1.00
R8673:Chchd6 UTSW 6 89569398 missense probably damaging 0.98
R9365:Chchd6 UTSW 6 89574431 missense probably benign 0.25
R9502:Chchd6 UTSW 6 89419781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGTCAGCATGGGACCTG -3'
(R):5'- TGGAAGGAACCTAGAAATGTCC -3'

Sequencing Primer
(F):5'- AGCATGGGACCTGCTGTTCTC -3'
(R):5'- ACCCACTTTGAAGAGCTGTTG -3'
Posted On 2015-10-08