Incidental Mutation 'R4635:Nphs1'
ID 349436
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4635 (G1)
Quality Score 219
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30468007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 787 (F787L)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: F787L

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: F787L

signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: F773L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: F773L

IG 38 132 1.38e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152625
Meta Mutation Damage Score 0.1382 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-10-08