Incidental Mutation 'R0266:Myh3'
ID34945
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission 038492-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R0266 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67093672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1085 (D1085G)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007301
AA Change: D1085G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: D1085G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108689
AA Change: D1085G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: D1085G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165221
AA Change: D1085G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: D1085G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Meta Mutation Damage Score 0.2142 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,754 S117P possibly damaging Het
Aars2 T C 17: 45,507,510 probably benign Het
Acot11 T C 4: 106,749,988 D466G probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Apbb2 A T 5: 66,302,611 N714K probably benign Het
Aqp12 C A 1: 93,006,850 H150N possibly damaging Het
Brinp3 T A 1: 146,682,680 L114* probably null Het
Ccng2 T C 5: 93,271,289 probably benign Het
Cd36 T A 5: 17,798,252 R265S probably benign Het
Ces4a T C 8: 105,141,966 L104S probably benign Het
Clca4b T C 3: 144,922,786 I387V probably damaging Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Ddx60 A T 8: 62,033,493 H1646L possibly damaging Het
Dntt T C 19: 41,059,127 I503T probably damaging Het
Dynlt1a T G 17: 6,317,395 E2D probably benign Het
Efemp2 G T 19: 5,477,999 C78F probably damaging Het
Esco1 T C 18: 10,594,605 E227G probably benign Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm17541 A T 12: 4,689,487 probably benign Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm4782 T G 6: 50,610,694 S686R probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Grm8 T C 6: 27,285,896 Y839C probably damaging Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hes6 A T 1: 91,412,304 D143E possibly damaging Het
Hmcn2 A G 2: 31,394,827 E2055G probably benign Het
Hmcn2 G A 2: 31,445,353 probably benign Het
Ikzf3 A G 11: 98,467,317 L398P probably benign Het
Il10ra A T 9: 45,265,652 I125N probably benign Het
Kcnb2 G A 1: 15,712,913 probably benign Het
Krt77 T C 15: 101,869,378 R81G possibly damaging Het
Lrrc40 T A 3: 158,041,661 probably null Het
Man1a2 C T 3: 100,582,034 R543Q probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mettl14 A T 3: 123,382,826 S58T probably benign Het
Mrpl4 T C 9: 21,003,314 V62A probably benign Het
Myo5c C A 9: 75,284,216 probably benign Het
Naalad2 G T 9: 18,350,943 probably benign Het
Nat3 A G 8: 67,547,780 T104A probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfm1 A G 2: 28,229,607 Y403C probably damaging Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr873 A T 9: 20,301,158 R320S probably benign Het
Osbpl1a T A 18: 12,871,163 probably null Het
Pax7 G A 4: 139,779,736 S330L possibly damaging Het
Pcdhb15 C A 18: 37,475,276 D520E probably damaging Het
Pgm3 T C 9: 86,567,533 T145A probably benign Het
Phox2b G A 5: 67,096,625 probably null Het
Pik3r6 A T 11: 68,526,408 R59* probably null Het
Pold1 A G 7: 44,541,025 probably benign Het
Ppp1r21 T C 17: 88,569,072 probably benign Het
Prl5a1 A G 13: 28,149,987 K158E possibly damaging Het
Rag2 T G 2: 101,630,603 C419W probably damaging Het
Reln A G 5: 21,988,776 S1395P probably damaging Het
Retnlb T G 16: 48,818,659 Y74* probably null Het
Robo3 A G 9: 37,422,640 S633P probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Slc6a5 C A 7: 49,938,408 probably benign Het
Sort1 T A 3: 108,344,931 N481K probably benign Het
Sptlc3 T A 2: 139,596,037 I417K possibly damaging Het
Svil T A 18: 5,099,063 probably benign Het
Taf4b T C 18: 14,813,077 probably benign Het
Tchp T C 5: 114,709,333 M71T possibly damaging Het
Thsd4 T A 9: 59,997,134 H233L probably benign Het
Tmem217 G T 17: 29,526,599 N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Uqcrfs1 A C 13: 30,541,163 N131K probably benign Het
Vars T A 17: 35,013,869 S896R probably benign Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wdr49 A T 3: 75,451,796 I8N possibly damaging Het
Zfp648 T A 1: 154,204,886 Y264N probably damaging Het
Zmym1 A C 4: 127,048,025 F857V possibly damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAAGGCTTCAGGGCGGAAGAACC -3'
(R):5'- TGCAAAGTCAGCCTGACAGAGTG -3'

Sequencing Primer
(F):5'- GAAATGATGCCTCTTGCAGC -3'
(R):5'- AGCCTGACAGAGTGAGGTCC -3'
Posted On2013-05-09