Incidental Mutation 'R4635:Daam1'
ID349453
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 71958744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably null
Transcript: ENSMUST00000085299
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221317
Predicted Effect probably null
Transcript: ENSMUST00000223272
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Shc2 C T 10: 79,626,286 C341Y probably benign Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGGAGCAAATGTCATCTATC -3'
(R):5'- GCATACTCTGGAGAGACAGTCC -3'

Sequencing Primer
(F):5'- GATCTTCACTGTATCTTCAGCCAGAC -3'
(R):5'- CAGTCCAGGAAGAGTTGAATCCC -3'
Posted On2015-10-08