Incidental Mutation 'R4675:Dnah7b'
ID 349459
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms LOC227058, Dnahc7b
MMRRC Submission 041930-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R4675 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 46105475-46412710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46256317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1873 (D1873E)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069293
AA Change: D1873E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: D1873E

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.0981 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C A 17: 36,203,820 (GRCm39) K291N probably damaging Het
Adgra1 A G 7: 139,456,102 (GRCm39) T577A probably damaging Het
Akip1 T A 7: 109,308,188 (GRCm39) I152N possibly damaging Het
Armc9 A G 1: 86,130,240 (GRCm39) Y8C probably damaging Het
Atp1a4 A T 1: 172,085,223 (GRCm39) V66E possibly damaging Het
Atp2a3 A T 11: 72,872,623 (GRCm39) T724S probably damaging Het
Bmp1 C A 14: 70,730,284 (GRCm39) R416L probably damaging Het
Bmt2 G T 6: 13,663,300 (GRCm39) A66E probably benign Het
Bscl2 A T 19: 8,825,523 (GRCm39) D403V possibly damaging Het
Cbx2 T A 11: 118,919,935 (GRCm39) I500N probably damaging Het
Cd84 A T 1: 171,700,887 (GRCm39) H216L possibly damaging Het
Cdhr18 A T 14: 13,856,724 (GRCm38) D462E probably benign Het
Ceacam15 T C 7: 16,407,410 (GRCm39) T36A probably benign Het
Cebpd A G 16: 15,705,385 (GRCm39) D66G probably damaging Het
Cntnap4 A G 8: 113,512,468 (GRCm39) Y610C probably damaging Het
Col11a2 T C 17: 34,283,267 (GRCm39) probably null Het
Col17a1 T C 19: 47,651,497 (GRCm39) probably null Het
Cracr2b A G 7: 141,043,451 (GRCm39) D43G probably damaging Het
Dgkz T A 2: 91,768,691 (GRCm39) K697* probably null Het
Dst G A 1: 34,314,784 (GRCm39) E6472K possibly damaging Het
Duox2 T C 2: 122,111,414 (GRCm39) D1428G probably damaging Het
Elmod2 T C 8: 84,043,537 (GRCm39) N210S probably damaging Het
Ephx1 A G 1: 180,822,256 (GRCm39) F220S probably damaging Het
F13b A G 1: 139,429,542 (GRCm39) Y20C unknown Het
Fbn2 T A 18: 58,173,265 (GRCm39) N2051I possibly damaging Het
Gabrg2 G A 11: 41,859,650 (GRCm39) H201Y probably damaging Het
Gbgt1 T C 2: 28,388,453 (GRCm39) F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 (GRCm39) S167P probably damaging Het
Heatr5a T C 12: 51,924,130 (GRCm39) N2028D probably benign Het
Heca T C 10: 17,791,057 (GRCm39) H333R probably benign Het
Herc1 T C 9: 66,298,740 (GRCm39) S625P probably damaging Het
Ighv1-55 T C 12: 115,172,175 (GRCm39) probably benign Het
Ighv5-8 G A 12: 113,618,777 (GRCm39) S64N probably benign Het
Itga1 G T 13: 115,138,227 (GRCm39) probably null Het
Kif21a C A 15: 90,824,748 (GRCm39) R1342L possibly damaging Het
Ksr1 G A 11: 78,965,186 (GRCm39) P118S possibly damaging Het
Lat2 T C 5: 134,634,911 (GRCm39) N100S probably damaging Het
Lrit3 T A 3: 129,582,121 (GRCm39) D501V probably damaging Het
Lrrfip1 T A 1: 91,031,042 (GRCm39) probably null Het
Lyst G A 13: 13,809,968 (GRCm39) R546H probably damaging Het
Med21 T A 6: 146,551,691 (GRCm39) L114H probably damaging Het
Mfap4 A T 11: 61,376,336 (GRCm39) probably benign Het
Mpdz G A 4: 81,302,049 (GRCm39) R233W probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Neto2 T G 8: 86,396,333 (GRCm39) H104P probably damaging Het
Nr1h2 T C 7: 44,201,979 (GRCm39) T36A possibly damaging Het
Nudt16l2 T C 9: 105,021,647 (GRCm39) D133G probably benign Het
Or13a20 A T 7: 140,232,074 (GRCm39) M61L probably damaging Het
Or4a79 T C 2: 89,551,838 (GRCm39) I206V probably benign Het
Or51ab3 T G 7: 103,201,183 (GRCm39) L64V probably damaging Het
Or51g2 A G 7: 102,623,013 (GRCm39) M62T probably damaging Het
Or52p1 T A 7: 104,267,631 (GRCm39) C248* probably null Het
Or5p52 A G 7: 107,502,567 (GRCm39) I214M probably damaging Het
Or5p72 T C 7: 108,022,309 (GRCm39) V177A possibly damaging Het
Or8b4 T C 9: 37,830,882 (GRCm39) *310R probably null Het
Pcbp3 A G 10: 76,606,869 (GRCm39) L241S possibly damaging Het
Pcf11 G A 7: 92,308,985 (GRCm39) probably benign Het
Podxl G A 6: 31,503,579 (GRCm39) T254M possibly damaging Het
Prr27 A C 5: 87,991,100 (GRCm39) E237D possibly damaging Het
Rdh16 G T 10: 127,637,316 (GRCm39) V84F probably damaging Het
Rnf26 A T 9: 44,023,428 (GRCm39) D273E probably benign Het
Rpl13a A T 7: 44,776,242 (GRCm39) probably benign Het
Rpl3l A G 17: 24,952,584 (GRCm39) K239E probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Rsf1 A AGGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Ryk A G 9: 102,768,415 (GRCm39) D352G possibly damaging Het
Setd1b T A 5: 123,299,061 (GRCm39) probably benign Het
Sh2b1 G A 7: 126,070,618 (GRCm39) A361V possibly damaging Het
Slc35f3 A T 8: 127,047,935 (GRCm39) K92* probably null Het
Slc39a10 A G 1: 46,857,144 (GRCm39) probably benign Het
Slc47a1 G A 11: 61,253,857 (GRCm39) T194I probably benign Het
Slc6a3 C A 13: 73,692,936 (GRCm39) N185K probably damaging Het
Stag1 T C 9: 100,730,758 (GRCm39) V391A probably damaging Het
Syne2 A C 12: 75,996,075 (GRCm39) N2206T probably damaging Het
Tbc1d23 C A 16: 57,003,325 (GRCm39) R481I possibly damaging Het
Tcstv7b T C 13: 120,702,362 (GRCm39) W53R probably damaging Het
Tfam A G 10: 71,069,225 (GRCm39) S166P probably benign Het
Tmem63a A G 1: 180,784,056 (GRCm39) H212R probably benign Het
Txndc11 T A 16: 10,902,745 (GRCm39) Q634L possibly damaging Het
Usp31 T C 7: 121,306,548 (GRCm39) probably benign Het
Vmn1r204 A T 13: 22,740,962 (GRCm39) M198L probably damaging Het
Vmn2r17 A T 5: 109,575,049 (GRCm39) T119S probably benign Het
Vsig1 A G X: 139,833,861 (GRCm39) D227G probably damaging Het
Zfhx2 G A 14: 55,304,678 (GRCm39) P1102L probably benign Het
Zfp715 T C 7: 42,949,444 (GRCm39) Q172R probably benign Het
Zfp872 A G 9: 22,108,701 (GRCm39) D53G probably damaging Het
Zswim8 G A 14: 20,764,681 (GRCm39) D684N probably benign Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,181,309 (GRCm39) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,250,497 (GRCm39) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,263,811 (GRCm39) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,105,889 (GRCm39) unclassified probably benign
IGL00950:Dnah7b APN 1 46,253,482 (GRCm39) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,234,538 (GRCm39) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,120,592 (GRCm39) splice site probably benign
IGL01392:Dnah7b APN 1 46,165,948 (GRCm39) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,155,460 (GRCm39) splice site probably benign
IGL01460:Dnah7b APN 1 46,178,864 (GRCm39) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,307,813 (GRCm39) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,397,307 (GRCm39) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,397,297 (GRCm39) nonsense probably null
IGL01906:Dnah7b APN 1 46,214,613 (GRCm39) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,163,497 (GRCm39) splice site probably benign
IGL01989:Dnah7b APN 1 46,328,694 (GRCm39) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,179,035 (GRCm39) missense probably benign
IGL02213:Dnah7b APN 1 46,272,752 (GRCm39) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,266,090 (GRCm39) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,138,663 (GRCm39) nonsense probably null
IGL02381:Dnah7b APN 1 46,316,280 (GRCm39) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,273,353 (GRCm39) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,234,478 (GRCm39) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,162,937 (GRCm39) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,155,461 (GRCm39) splice site probably benign
IGL02704:Dnah7b APN 1 46,181,293 (GRCm39) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,138,768 (GRCm39) splice site probably benign
IGL02745:Dnah7b APN 1 46,234,189 (GRCm39) splice site probably benign
IGL02818:Dnah7b APN 1 46,329,968 (GRCm39) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,158,458 (GRCm39) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,221,535 (GRCm39) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,124,849 (GRCm39) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,158,464 (GRCm39) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,412,508 (GRCm39) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,252,520 (GRCm39) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,262,338 (GRCm39) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,258,508 (GRCm39) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,162,937 (GRCm39) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,246,803 (GRCm39) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,173,816 (GRCm39) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,280,104 (GRCm39) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,316,286 (GRCm39) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,275,948 (GRCm39) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,179,336 (GRCm39) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,258,704 (GRCm39) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,280,152 (GRCm39) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,379,292 (GRCm39) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,138,772 (GRCm39) splice site probably benign
R1035:Dnah7b UTSW 1 46,163,608 (GRCm39) missense probably benign
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,364,970 (GRCm39) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,379,280 (GRCm39) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,138,669 (GRCm39) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,328,816 (GRCm39) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,117,753 (GRCm39) splice site probably benign
R1484:Dnah7b UTSW 1 46,176,703 (GRCm39) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,216,441 (GRCm39) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,105,957 (GRCm39) missense unknown
R1607:Dnah7b UTSW 1 46,329,806 (GRCm39) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,392,126 (GRCm39) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,214,550 (GRCm39) nonsense probably null
R1681:Dnah7b UTSW 1 46,363,872 (GRCm39) nonsense probably null
R1716:Dnah7b UTSW 1 46,230,943 (GRCm39) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,272,919 (GRCm39) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,316,265 (GRCm39) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,155,337 (GRCm39) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,275,874 (GRCm39) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,281,263 (GRCm39) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,181,247 (GRCm39) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,281,481 (GRCm39) nonsense probably null
R2083:Dnah7b UTSW 1 46,280,227 (GRCm39) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,137,152 (GRCm39) splice site probably benign
R2172:Dnah7b UTSW 1 46,163,672 (GRCm39) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,240,344 (GRCm39) splice site probably benign
R2247:Dnah7b UTSW 1 46,316,223 (GRCm39) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,273,075 (GRCm39) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,402,114 (GRCm39) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,234,447 (GRCm39) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,178,901 (GRCm39) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,246,732 (GRCm39) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,227,847 (GRCm39) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,221,583 (GRCm39) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,307,869 (GRCm39) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,392,033 (GRCm39) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,339,035 (GRCm39) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,282,417 (GRCm39) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,176,645 (GRCm39) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,272,871 (GRCm39) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,120,655 (GRCm39) missense probably benign
R4172:Dnah7b UTSW 1 46,266,106 (GRCm39) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,176,578 (GRCm39) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,260,932 (GRCm39) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
R4414:Dnah7b UTSW 1 46,165,840 (GRCm39) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,124,792 (GRCm39) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,328,696 (GRCm39) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,117,684 (GRCm39) missense probably damaging 1.00
R4685:Dnah7b UTSW 1 46,250,488 (GRCm39) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,246,816 (GRCm39) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,106,115 (GRCm39) missense unknown
R4780:Dnah7b UTSW 1 46,392,174 (GRCm39) missense probably benign
R4828:Dnah7b UTSW 1 46,167,272 (GRCm39) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,395,762 (GRCm39) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,234,234 (GRCm39) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,120,604 (GRCm39) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,240,478 (GRCm39) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,329,935 (GRCm39) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,272,886 (GRCm39) missense probably benign
R5000:Dnah7b UTSW 1 46,138,663 (GRCm39) nonsense probably null
R5005:Dnah7b UTSW 1 46,281,188 (GRCm39) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,226,523 (GRCm39) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,221,540 (GRCm39) nonsense probably null
R5174:Dnah7b UTSW 1 46,282,509 (GRCm39) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,397,376 (GRCm39) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,273,018 (GRCm39) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,412,514 (GRCm39) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,272,849 (GRCm39) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,256,351 (GRCm39) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,227,819 (GRCm39) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,397,431 (GRCm39) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,281,366 (GRCm39) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,281,179 (GRCm39) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,148,472 (GRCm39) missense probably null
R5479:Dnah7b UTSW 1 46,262,265 (GRCm39) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,281,359 (GRCm39) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,395,674 (GRCm39) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,307,924 (GRCm39) splice site probably null
R5659:Dnah7b UTSW 1 46,392,009 (GRCm39) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,273,152 (GRCm39) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,316,280 (GRCm39) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,181,292 (GRCm39) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,230,885 (GRCm39) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,376,753 (GRCm39) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,260,803 (GRCm39) missense probably benign
R5941:Dnah7b UTSW 1 46,226,450 (GRCm39) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,402,147 (GRCm39) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,158,558 (GRCm39) splice site probably null
R6041:Dnah7b UTSW 1 46,328,805 (GRCm39) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,178,949 (GRCm39) missense probably benign
R6049:Dnah7b UTSW 1 46,124,762 (GRCm39) missense probably benign
R6131:Dnah7b UTSW 1 46,292,626 (GRCm39) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,329,863 (GRCm39) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,272,745 (GRCm39) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,165,828 (GRCm39) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,265,048 (GRCm39) missense probably benign
R6273:Dnah7b UTSW 1 46,281,476 (GRCm39) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,379,335 (GRCm39) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,281,364 (GRCm39) nonsense probably null
R6494:Dnah7b UTSW 1 46,138,591 (GRCm39) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,263,902 (GRCm39) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,379,377 (GRCm39) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,230,948 (GRCm39) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,234,280 (GRCm39) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,158,428 (GRCm39) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,397,398 (GRCm39) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,234,299 (GRCm39) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,275,969 (GRCm39) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,391,973 (GRCm39) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,178,870 (GRCm39) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,281,302 (GRCm39) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,179,126 (GRCm39) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,122,914 (GRCm39) missense probably benign
R7244:Dnah7b UTSW 1 46,316,303 (GRCm39) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,181,245 (GRCm39) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,234,532 (GRCm39) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,342,794 (GRCm39) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,214,579 (GRCm39) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,329,894 (GRCm39) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,364,925 (GRCm39) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,395,714 (GRCm39) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,163,506 (GRCm39) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,253,573 (GRCm39) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,307,794 (GRCm39) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,148,462 (GRCm39) missense probably benign
R7676:Dnah7b UTSW 1 46,273,324 (GRCm39) nonsense probably null
R7731:Dnah7b UTSW 1 46,178,905 (GRCm39) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,240,413 (GRCm39) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,176,634 (GRCm39) missense probably benign
R7807:Dnah7b UTSW 1 46,253,527 (GRCm39) missense probably benign
R7895:Dnah7b UTSW 1 46,289,110 (GRCm39) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,178,838 (GRCm39) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,266,163 (GRCm39) missense probably benign
R7946:Dnah7b UTSW 1 46,272,739 (GRCm39) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,282,584 (GRCm39) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,282,525 (GRCm39) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,263,866 (GRCm39) nonsense probably null
R8094:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,272,913 (GRCm39) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,292,671 (GRCm39) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,395,736 (GRCm39) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,179,032 (GRCm39) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,214,456 (GRCm39) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,395,819 (GRCm39) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,227,839 (GRCm39) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,329,875 (GRCm39) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,138,650 (GRCm39) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,155,360 (GRCm39) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,214,598 (GRCm39) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,221,624 (GRCm39) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,392,159 (GRCm39) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,162,806 (GRCm39) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,273,305 (GRCm39) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,230,953 (GRCm39) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,280,236 (GRCm39) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,292,534 (GRCm39) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,262,232 (GRCm39) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,282,575 (GRCm39) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,173,674 (GRCm39) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,266,180 (GRCm39) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,181,194 (GRCm39) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,330,038 (GRCm39) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,361,420 (GRCm39) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,272,914 (GRCm39) nonsense probably null
R9392:Dnah7b UTSW 1 46,162,898 (GRCm39) nonsense probably null
R9456:Dnah7b UTSW 1 46,165,953 (GRCm39) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,253,564 (GRCm39) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,264,956 (GRCm39) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,292,621 (GRCm39) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,252,544 (GRCm39) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
RF020:Dnah7b UTSW 1 46,412,421 (GRCm39) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,412,458 (GRCm39) nonsense probably null
X0023:Dnah7b UTSW 1 46,342,737 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGATAGGATGAGACAGGCACCA -3'
(R):5'- TAGGCTCCTACAACTTCCCT -3'

Sequencing Primer
(F):5'- CAGGCACCATACAGGAGATGTG -3'
(R):5'- TTGCCTGCAAGAGCTGTAAC -3'
Posted On 2015-10-08