Incidental Mutation 'R4675:Slc39a10'
ID349460
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Namesolute carrier family 39 (zinc transporter), member 10
Synonyms2900042E17Rik
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R4675 (G1)
Quality Score193
Status Validated
Chromosome1
Chromosomal Location46807544-46892852 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 46817984 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131]
Predicted Effect probably benign
Transcript: ENSMUST00000027131
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141226
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc47a1 G A 11: 61,363,031 T194I probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46836070 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4689:Slc39a10 UTSW 1 46836013 missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46827407 missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46835720 missense probably damaging 1.00
R7222:Slc39a10 UTSW 1 46819292 missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
R7974:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
RF020:Slc39a10 UTSW 1 46810015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCACAATCAGGCATTGGAG -3'
(R):5'- GTGTTCATCATCCTCTCCAGGG -3'

Sequencing Primer
(F):5'- GGCATCAGATCTCGTTACAGATGC -3'
(R):5'- TCTCCAGGGGCAGCTTTCAG -3'
Posted On2015-10-08