Mutagenetix > Incidental Mutation

Incidental Mutation 'R4675:Atp1a4'

349464

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

041930-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4675 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 172257656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 66 (V66E)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243] [ENSMUST00000139528]

AlphaFold

Q9WV27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111243
AA Change: V66E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: V66E

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139528

SMART Domains

Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

Domain	Start	End	E-Value	Type
IG_like	19	84	3.66e1	SMART
low complexity region	92	103	N/A	INTRINSIC
IG	106	222	2.3e-3	SMART
IG	246	370	9.49e-5	SMART
IG	382	508	3.59e-5	SMART
transmembrane domain	515	537	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193316

Meta Mutation Damage Score

0.4640

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

95% (89/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	T	C	9: 105,144,448	D133G	probably benign	Het
2310061I04Rik	C	A	17: 35,892,928	K291N	probably damaging	Het
Adgra1	A	G	7: 139,876,186	T577A	probably damaging	Het
Akip1	T	A	7: 109,708,981	I152N	possibly damaging	Het
Armc9	A	G	1: 86,202,518	Y8C	probably damaging	Het
Atp2a3	A	T	11: 72,981,797	T724S	probably damaging	Het
Bmp1	C	A	14: 70,492,844	R416L	probably damaging	Het
Bmt2	G	T	6: 13,663,301	A66E	probably benign	Het
Bscl2	A	T	19: 8,848,159	D403V	possibly damaging	Het
Cbx2	T	A	11: 119,029,109	I500N	probably damaging	Het
Cd84	A	T	1: 171,873,320	H216L	possibly damaging	Het
Ceacam15	T	C	7: 16,673,485	T36A	probably benign	Het
Cebpd	A	G	16: 15,887,521	D66G	probably damaging	Het
Cntnap4	A	G	8: 112,785,836	Y610C	probably damaging	Het
Col11a2	T	C	17: 34,064,293		probably null	Het
Col17a1	T	C	19: 47,663,058		probably null	Het
Cracr2b	A	G	7: 141,463,538	D43G	probably damaging	Het
Dgkz	T	A	2: 91,938,346	K697*	probably null	Het
Dnah7b	T	A	1: 46,217,157	D1873E	possibly damaging	Het
Dst	G	A	1: 34,275,703	E6472K	possibly damaging	Het
Duox2	T	C	2: 122,280,933	D1428G	probably damaging	Het
Elmod2	T	C	8: 83,316,908	N210S	probably damaging	Het
Ephx1	A	G	1: 180,994,691	F220S	probably damaging	Het
F13b	A	G	1: 139,501,804	Y20C	unknown	Het
Fbn2	T	A	18: 58,040,193	N2051I	possibly damaging	Het
Gabrg2	G	A	11: 41,968,823	H201Y	probably damaging	Het
Gbgt1	T	C	2: 28,498,441	F46S	possibly damaging	Het
Gjd4	A	G	18: 9,280,578	S167P	probably damaging	Het
Gm21731	T	C	13: 120,240,826	W53R	probably damaging	Het
Gm281	A	T	14: 13,856,724	D462E	probably benign	Het
Heatr5a	T	C	12: 51,877,347	N2028D	probably benign	Het
Heca	T	C	10: 17,915,309	H333R	probably benign	Het
Herc1	T	C	9: 66,391,458	S625P	probably damaging	Het
Ighv1-55	T	C	12: 115,208,555		probably benign	Het
Ighv5-8	G	A	12: 113,655,157	S64N	probably benign	Het
Itga1	G	T	13: 115,001,691		probably null	Het
Kif21a	C	A	15: 90,940,545	R1342L	possibly damaging	Het
Ksr1	G	A	11: 79,074,360	P118S	possibly damaging	Het
Lat2	T	C	5: 134,606,057	N100S	probably damaging	Het
Lrit3	T	A	3: 129,788,472	D501V	probably damaging	Het
Lrrfip1	T	A	1: 91,103,320		probably null	Het
Lyst	G	A	13: 13,635,383	R546H	probably damaging	Het
Med21	T	A	6: 146,650,193	L114H	probably damaging	Het
Mfap4	A	T	11: 61,485,510		probably benign	Het
Mpdz	G	A	4: 81,383,812	R233W	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Neto2	T	G	8: 85,669,704	H104P	probably damaging	Het
Nr1h2	T	C	7: 44,552,555	T36A	possibly damaging	Het
Olfr1252	T	C	2: 89,721,494	I206V	probably benign	Het
Olfr472	A	G	7: 107,903,360	I214M	probably damaging	Het
Olfr497	T	C	7: 108,423,102	V177A	possibly damaging	Het
Olfr53	A	T	7: 140,652,161	M61L	probably damaging	Het
Olfr577	A	G	7: 102,973,806	M62T	probably damaging	Het
Olfr613	T	G	7: 103,551,976	L64V	probably damaging	Het
Olfr656	T	A	7: 104,618,424	C248*	probably null	Het
Olfr878	T	C	9: 37,919,586	*310R	probably null	Het
Pcbp3	A	G	10: 76,771,035	L241S	possibly damaging	Het
Pcf11	G	A	7: 92,659,777		probably benign	Het
Podxl	G	A	6: 31,526,644	T254M	possibly damaging	Het
Prr27	A	C	5: 87,843,241	E237D	possibly damaging	Het
Rdh16	G	T	10: 127,801,447	V84F	probably damaging	Het
Rnf26	A	T	9: 44,112,131	D273E	probably benign	Het
Rpl13a	A	T	7: 45,126,818		probably benign	Het
Rpl3l	A	G	17: 24,733,610	K239E	probably benign	Het
Rsf1	A	AGGGCGACGG	7: 97,579,904		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Ryk	A	G	9: 102,891,216	D352G	possibly damaging	Het
Setd1b	T	A	5: 123,160,998		probably benign	Het
Sh2b1	G	A	7: 126,471,446	A361V	possibly damaging	Het
Slc35f3	A	T	8: 126,321,196	K92*	probably null	Het
Slc39a10	A	G	1: 46,817,984		probably benign	Het
Slc47a1	G	A	11: 61,363,031	T194I	probably benign	Het
Slc6a3	C	A	13: 73,544,817	N185K	probably damaging	Het
Stag1	T	C	9: 100,848,705	V391A	probably damaging	Het
Syne2	A	C	12: 75,949,301	N2206T	probably damaging	Het
Tbc1d23	C	A	16: 57,182,962	R481I	possibly damaging	Het
Tfam	A	G	10: 71,233,395	S166P	probably benign	Het
Tmem63a	A	G	1: 180,956,491	H212R	probably benign	Het
Txndc11	T	A	16: 11,084,881	Q634L	possibly damaging	Het
Usp31	T	C	7: 121,707,325		probably benign	Het
Vmn1r204	A	T	13: 22,556,792	M198L	probably damaging	Het
Vmn2r17	A	T	5: 109,427,183	T119S	probably benign	Het
Vsig1	A	G	X: 140,933,112	D227G	probably damaging	Het
Zfhx2	G	A	14: 55,067,221	P1102L	probably benign	Het
Zfp715	T	C	7: 43,300,020	Q172R	probably benign	Het
Zfp872	A	G	9: 22,197,405	D53G	probably damaging	Het
Zswim8	G	A	14: 20,714,613	D684N	probably benign	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CCAAGTAGAGTTGTGTGGAGC -3'
(R):5'- TTATGGTGAGGATGGCCAAAGC -3'

Sequencing Primer
(F):5'- AGCTTTGCGGGGCTAAG -3'
(R):5'- TGCCCTTGAAAGACCCTTCAG -3'

Posted On

2015-10-08