Mutagenetix > Incidental Mutations

Incidental Mutation 'R4675:Ncapd3'

349503

Institutional Source

Beutler Lab

Gene Symbol

Ncapd3

Ensembl Gene

ENSMUSG00000035024

Gene Name

non-SMC condensin II complex, subunit D3

Synonyms

4632407J06Rik, B130055D15Rik, 2810487N22Rik

MMRRC Submission

041930-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R4675 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27030175-27095315 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 27094742 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034472] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]

Predicted Effect

probably benign
Transcript: ENSMUST00000034472

SMART Domains

Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	38	136	2.7e-9	SMART
IGc2	151	226	8.12e-13	SMART
transmembrane domain	245	267	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000073127

SMART Domains

Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cnd1	949	1148	1.7e-46	PFAM
low complexity region	1192	1200	N/A	INTRINSIC
coiled coil region	1213	1270	N/A	INTRINSIC
low complexity region	1290	1315	N/A	INTRINSIC
low complexity region	1393	1410	N/A	INTRINSIC
low complexity region	1485	1498	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000086198
AA Change: S1212P

SMART Domains

Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: S1212P

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cohesin_HEAT	536	560	4.6e-5	PFAM
Pfam:Cnd1	949	1148	6.6e-59	PFAM
low complexity region	1192	1200	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214432

Predicted Effect

silent
Transcript: ENSMUST00000216677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217654

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

95% (89/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	T	C	9: 105,144,448	D133G	probably benign	Het
2310061I04Rik	C	A	17: 35,892,928	K291N	probably damaging	Het
Adgra1	A	G	7: 139,876,186	T577A	probably damaging	Het
Akip1	T	A	7: 109,708,981	I152N	possibly damaging	Het
Armc9	A	G	1: 86,202,518	Y8C	probably damaging	Het
Atp1a4	A	T	1: 172,257,656	V66E	possibly damaging	Het
Atp2a3	A	T	11: 72,981,797	T724S	probably damaging	Het
Bmp1	C	A	14: 70,492,844	R416L	probably damaging	Het
Bmt2	G	T	6: 13,663,301	A66E	probably benign	Het
Bscl2	A	T	19: 8,848,159	D403V	possibly damaging	Het
Cbx2	T	A	11: 119,029,109	I500N	probably damaging	Het
Cd84	A	T	1: 171,873,320	H216L	possibly damaging	Het
Ceacam15	T	C	7: 16,673,485	T36A	probably benign	Het
Cebpd	A	G	16: 15,887,521	D66G	probably damaging	Het
Cntnap4	A	G	8: 112,785,836	Y610C	probably damaging	Het
Col11a2	T	C	17: 34,064,293		probably null	Het
Col17a1	T	C	19: 47,663,058		probably null	Het
Cracr2b	A	G	7: 141,463,538	D43G	probably damaging	Het
Dgkz	T	A	2: 91,938,346	K697*	probably null	Het
Dnah7b	T	A	1: 46,217,157	D1873E	possibly damaging	Het
Dst	G	A	1: 34,275,703	E6472K	possibly damaging	Het
Duox2	T	C	2: 122,280,933	D1428G	probably damaging	Het
Elmod2	T	C	8: 83,316,908	N210S	probably damaging	Het
Ephx1	A	G	1: 180,994,691	F220S	probably damaging	Het
F13b	A	G	1: 139,501,804	Y20C	unknown	Het
Fbn2	T	A	18: 58,040,193	N2051I	possibly damaging	Het
Gabrg2	G	A	11: 41,968,823	H201Y	probably damaging	Het
Gbgt1	T	C	2: 28,498,441	F46S	possibly damaging	Het
Gjd4	A	G	18: 9,280,578	S167P	probably damaging	Het
Gm21731	T	C	13: 120,240,826	W53R	probably damaging	Het
Gm281	A	T	14: 13,856,724	D462E	probably benign	Het
Heatr5a	T	C	12: 51,877,347	N2028D	probably benign	Het
Heca	T	C	10: 17,915,309	H333R	probably benign	Het
Herc1	T	C	9: 66,391,458	S625P	probably damaging	Het
Ighv1-55	T	C	12: 115,208,555		probably benign	Het
Ighv5-8	G	A	12: 113,655,157	S64N	probably benign	Het
Itga1	G	T	13: 115,001,691		probably null	Het
Kif21a	C	A	15: 90,940,545	R1342L	possibly damaging	Het
Ksr1	G	A	11: 79,074,360	P118S	possibly damaging	Het
Lat2	T	C	5: 134,606,057	N100S	probably damaging	Het
Lrit3	T	A	3: 129,788,472	D501V	probably damaging	Het
Lrrfip1	T	A	1: 91,103,320		probably null	Het
Lyst	G	A	13: 13,635,383	R546H	probably damaging	Het
Med21	T	A	6: 146,650,193	L114H	probably damaging	Het
Mfap4	A	T	11: 61,485,510		probably benign	Het
Mpdz	G	A	4: 81,383,812	R233W	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Neto2	T	G	8: 85,669,704	H104P	probably damaging	Het
Nr1h2	T	C	7: 44,552,555	T36A	possibly damaging	Het
Olfr1252	T	C	2: 89,721,494	I206V	probably benign	Het
Olfr472	A	G	7: 107,903,360	I214M	probably damaging	Het
Olfr497	T	C	7: 108,423,102	V177A	possibly damaging	Het
Olfr53	A	T	7: 140,652,161	M61L	probably damaging	Het
Olfr577	A	G	7: 102,973,806	M62T	probably damaging	Het
Olfr613	T	G	7: 103,551,976	L64V	probably damaging	Het
Olfr656	T	A	7: 104,618,424	C248*	probably null	Het
Olfr878	T	C	9: 37,919,586	*310R	probably null	Het
Pcbp3	A	G	10: 76,771,035	L241S	possibly damaging	Het
Pcf11	G	A	7: 92,659,777		probably benign	Het
Podxl	G	A	6: 31,526,644	T254M	possibly damaging	Het
Prr27	A	C	5: 87,843,241	E237D	possibly damaging	Het
Rdh16	G	T	10: 127,801,447	V84F	probably damaging	Het
Rnf26	A	T	9: 44,112,131	D273E	probably benign	Het
Rpl13a	A	T	7: 45,126,818		probably benign	Het
Rpl3l	A	G	17: 24,733,610	K239E	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Rsf1	A	AGGGCGACGG	7: 97,579,904		probably null	Het
Ryk	A	G	9: 102,891,216	D352G	possibly damaging	Het
Setd1b	T	A	5: 123,160,998		probably benign	Het
Sh2b1	G	A	7: 126,471,446	A361V	possibly damaging	Het
Slc35f3	A	T	8: 126,321,196	K92*	probably null	Het
Slc39a10	A	G	1: 46,817,984		probably benign	Het
Slc47a1	G	A	11: 61,363,031	T194I	probably benign	Het
Slc6a3	C	A	13: 73,544,817	N185K	probably damaging	Het
Stag1	T	C	9: 100,848,705	V391A	probably damaging	Het
Syne2	A	C	12: 75,949,301	N2206T	probably damaging	Het
Tbc1d23	C	A	16: 57,182,962	R481I	possibly damaging	Het
Tfam	A	G	10: 71,233,395	S166P	probably benign	Het
Tmem63a	A	G	1: 180,956,491	H212R	probably benign	Het
Txndc11	T	A	16: 11,084,881	Q634L	possibly damaging	Het
Usp31	T	C	7: 121,707,325		probably benign	Het
Vmn1r204	A	T	13: 22,556,792	M198L	probably damaging	Het
Vmn2r17	A	T	5: 109,427,183	T119S	probably benign	Het
Vsig1	A	G	X: 140,933,112	D227G	probably damaging	Het
Zfhx2	G	A	14: 55,067,221	P1102L	probably benign	Het
Zfp715	T	C	7: 43,300,020	Q172R	probably benign	Het
Zfp872	A	G	9: 22,197,405	D53G	probably damaging	Het
Zswim8	G	A	14: 20,714,613	D684N	probably benign	Het

Other mutations in Ncapd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Ncapd3	APN	9	27052353	missense	probably benign
IGL00544:Ncapd3	APN	9	27063338	missense	possibly damaging	0.94
IGL01657:Ncapd3	APN	9	27071824	missense	possibly damaging	0.81
IGL01979:Ncapd3	APN	9	27071965	critical splice donor site	probably null
IGL02073:Ncapd3	APN	9	27063316	missense	probably benign	0.03
IGL02083:Ncapd3	APN	9	27051821	missense	probably damaging	1.00
IGL02383:Ncapd3	APN	9	27050328	missense	probably benign	0.44
IGL02429:Ncapd3	APN	9	27089302	missense	probably benign	0.08
IGL02437:Ncapd3	APN	9	27063968	splice site	probably benign
IGL02861:Ncapd3	APN	9	27069899	missense	probably benign	0.00
IGL03202:Ncapd3	APN	9	27071715	splice site	probably benign
IGL03219:Ncapd3	APN	9	27063873	splice site	probably benign
IGL03252:Ncapd3	APN	9	27051449	missense	probably damaging	1.00
pevensie	UTSW	9	27086046	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0084:Ncapd3	UTSW	9	27056111	missense	probably damaging	0.98
R0491:Ncapd3	UTSW	9	27057883	missense	probably damaging	0.97
R0513:Ncapd3	UTSW	9	27064105	splice site	probably benign
R0565:Ncapd3	UTSW	9	27087998	missense	probably benign	0.00
R0601:Ncapd3	UTSW	9	27041507	missense	probably benign	0.05
R0671:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0673:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0842:Ncapd3	UTSW	9	27037084	missense	probably benign	0.01
R1178:Ncapd3	UTSW	9	27041421	missense	probably benign
R1366:Ncapd3	UTSW	9	27057940	missense	probably damaging	1.00
R1432:Ncapd3	UTSW	9	27069872	splice site	probably benign
R1439:Ncapd3	UTSW	9	27087566	critical splice donor site	probably null
R1532:Ncapd3	UTSW	9	27083360	nonsense	probably null
R2131:Ncapd3	UTSW	9	27083346	missense	probably damaging	0.98
R2178:Ncapd3	UTSW	9	27088549	missense	probably benign	0.01
R2238:Ncapd3	UTSW	9	27067024	missense	probably benign
R2258:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2259:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2260:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2297:Ncapd3	UTSW	9	27041501	nonsense	probably null
R2877:Ncapd3	UTSW	9	27044487	splice site	probably null
R3612:Ncapd3	UTSW	9	27050357	missense	probably damaging	1.00
R3709:Ncapd3	UTSW	9	27052349	missense	probably benign	0.00
R3791:Ncapd3	UTSW	9	27052635	missense	probably benign	0.27
R4052:Ncapd3	UTSW	9	27089383	splice site	probably null
R4297:Ncapd3	UTSW	9	27052327	missense	probably benign
R4299:Ncapd3	UTSW	9	27052327	missense	probably benign
R4441:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R4572:Ncapd3	UTSW	9	27094615	missense	probably damaging	1.00
R4790:Ncapd3	UTSW	9	27051850	missense	probably benign	0.00
R4835:Ncapd3	UTSW	9	27086046	missense	probably damaging	1.00
R4919:Ncapd3	UTSW	9	27051775	missense	possibly damaging	0.95
R4928:Ncapd3	UTSW	9	27071735	nonsense	probably null
R4939:Ncapd3	UTSW	9	27063869	critical splice donor site	probably null
R4980:Ncapd3	UTSW	9	27063295	missense	probably damaging	0.99
R5030:Ncapd3	UTSW	9	27071766	missense	probably damaging	0.98
R5052:Ncapd3	UTSW	9	27051719	missense	probably damaging	1.00
R5180:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5343:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R5656:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5840:Ncapd3	UTSW	9	27094758	missense	probably benign	0.00
R5900:Ncapd3	UTSW	9	27066969	missense	probably benign	0.26
R6093:Ncapd3	UTSW	9	27056158	missense	probably damaging	0.99
R6122:Ncapd3	UTSW	9	27063982	missense	probably benign	0.00
R6249:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R6428:Ncapd3	UTSW	9	27052664	splice site	probably null
R6432:Ncapd3	UTSW	9	27044509	missense	probably damaging	0.98
R6441:Ncapd3	UTSW	9	27063416	missense	probably benign	0.03
R6459:Ncapd3	UTSW	9	27051755	missense	probably benign	0.00
R6567:Ncapd3	UTSW	9	27067004	missense	possibly damaging	0.83
R6722:Ncapd3	UTSW	9	27087556	missense	probably benign
R6862:Ncapd3	UTSW	9	27030809	missense	probably damaging	0.98
R7234:Ncapd3	UTSW	9	27050359	missense	probably damaging	0.97
R7286:Ncapd3	UTSW	9	27069958	missense	probably damaging	1.00
R7404:Ncapd3	UTSW	9	27067019	missense	probably benign	0.01
R7541:Ncapd3	UTSW	9	27067040	missense	probably damaging	0.99
R7583:Ncapd3	UTSW	9	27071848	missense	probably damaging	1.00
R7655:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7656:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7815:Ncapd3	UTSW	9	27063440	nonsense	probably null
R7876:Ncapd3	UTSW	9	27045223	critical splice donor site	probably null
R7913:Ncapd3	UTSW	9	27048226	nonsense	probably null
R8068:Ncapd3	UTSW	9	27063361	missense	possibly damaging	0.66
R8147:Ncapd3	UTSW	9	27030718	start gained	probably benign
R8197:Ncapd3	UTSW	9	27086033	missense	probably damaging	0.98
R8264:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R8353:Ncapd3	UTSW	9	27071804	missense	probably benign	0.03
R8539:Ncapd3	UTSW	9	27048224	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGTCAGAGAAACACGAAGCC -3'
(R):5'- GTTGGTTAGACAAACACAAGCTG -3'

Sequencing Primer
(F):5'- GCCCAAGAACAAGGAAGTGAC -3'
(R):5'- GACACACTGATGTCCTAGGCAG -3'

Posted On

2015-10-08