Incidental Mutation 'R4675:Herc1'
ID 349506
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 041930-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4675 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 66350450-66508775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66391458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 625 (S625P)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042824
AA Change: S625P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: S625P

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Meta Mutation Damage Score 0.4220 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 (GRCm38) D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 (GRCm38) K291N probably damaging Het
Adgra1 A G 7: 139,876,186 (GRCm38) T577A probably damaging Het
Akip1 T A 7: 109,708,981 (GRCm38) I152N possibly damaging Het
Armc9 A G 1: 86,202,518 (GRCm38) Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 (GRCm38) V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 (GRCm38) T724S probably damaging Het
Bmp1 C A 14: 70,492,844 (GRCm38) R416L probably damaging Het
Bmt2 G T 6: 13,663,301 (GRCm38) A66E probably benign Het
Bscl2 A T 19: 8,848,159 (GRCm38) D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 (GRCm38) I500N probably damaging Het
Cd84 A T 1: 171,873,320 (GRCm38) H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 (GRCm38) T36A probably benign Het
Cebpd A G 16: 15,887,521 (GRCm38) D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 (GRCm38) Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 (GRCm38) probably null Het
Col17a1 T C 19: 47,663,058 (GRCm38) probably null Het
Cracr2b A G 7: 141,463,538 (GRCm38) D43G probably damaging Het
Dgkz T A 2: 91,938,346 (GRCm38) K697* probably null Het
Dnah7b T A 1: 46,217,157 (GRCm38) D1873E possibly damaging Het
Dst G A 1: 34,275,703 (GRCm38) E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 (GRCm38) D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 (GRCm38) N210S probably damaging Het
Ephx1 A G 1: 180,994,691 (GRCm38) F220S probably damaging Het
F13b A G 1: 139,501,804 (GRCm38) Y20C unknown Het
Fbn2 T A 18: 58,040,193 (GRCm38) N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 (GRCm38) H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 (GRCm38) F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 (GRCm38) S167P probably damaging Het
Gm21731 T C 13: 120,240,826 (GRCm38) W53R probably damaging Het
Gm281 A T 14: 13,856,724 (GRCm38) D462E probably benign Het
Heatr5a T C 12: 51,877,347 (GRCm38) N2028D probably benign Het
Heca T C 10: 17,915,309 (GRCm38) H333R probably benign Het
Ighv1-55 T C 12: 115,208,555 (GRCm38) probably benign Het
Ighv5-8 G A 12: 113,655,157 (GRCm38) S64N probably benign Het
Itga1 G T 13: 115,001,691 (GRCm38) probably null Het
Kif21a C A 15: 90,940,545 (GRCm38) R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 (GRCm38) P118S possibly damaging Het
Lat2 T C 5: 134,606,057 (GRCm38) N100S probably damaging Het
Lrit3 T A 3: 129,788,472 (GRCm38) D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 (GRCm38) probably null Het
Lyst G A 13: 13,635,383 (GRCm38) R546H probably damaging Het
Med21 T A 6: 146,650,193 (GRCm38) L114H probably damaging Het
Mfap4 A T 11: 61,485,510 (GRCm38) probably benign Het
Mpdz G A 4: 81,383,812 (GRCm38) R233W probably damaging Het
Mrc2 G A 11: 105,348,431 (GRCm38) probably null Het
Ncapd3 T C 9: 27,094,742 (GRCm38) probably benign Het
Neto2 T G 8: 85,669,704 (GRCm38) H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 (GRCm38) T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 (GRCm38) I206V probably benign Het
Olfr472 A G 7: 107,903,360 (GRCm38) I214M probably damaging Het
Olfr497 T C 7: 108,423,102 (GRCm38) V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 (GRCm38) M61L probably damaging Het
Olfr577 A G 7: 102,973,806 (GRCm38) M62T probably damaging Het
Olfr613 T G 7: 103,551,976 (GRCm38) L64V probably damaging Het
Olfr656 T A 7: 104,618,424 (GRCm38) C248* probably null Het
Olfr878 T C 9: 37,919,586 (GRCm38) *310R probably null Het
Pcbp3 A G 10: 76,771,035 (GRCm38) L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 (GRCm38) probably benign Het
Podxl G A 6: 31,526,644 (GRCm38) T254M possibly damaging Het
Prr27 A C 5: 87,843,241 (GRCm38) E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 (GRCm38) V84F probably damaging Het
Rnf26 A T 9: 44,112,131 (GRCm38) D273E probably benign Het
Rpl13a A T 7: 45,126,818 (GRCm38) probably benign Het
Rpl3l A G 17: 24,733,610 (GRCm38) K239E probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 (GRCm38) probably null Het
Rsf1 G A 7: 97,579,910 (GRCm38) probably benign Het
Ryk A G 9: 102,891,216 (GRCm38) D352G possibly damaging Het
Setd1b T A 5: 123,160,998 (GRCm38) probably benign Het
Sh2b1 G A 7: 126,471,446 (GRCm38) A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 (GRCm38) K92* probably null Het
Slc39a10 A G 1: 46,817,984 (GRCm38) probably benign Het
Slc47a1 G A 11: 61,363,031 (GRCm38) T194I probably benign Het
Slc6a3 C A 13: 73,544,817 (GRCm38) N185K probably damaging Het
Stag1 T C 9: 100,848,705 (GRCm38) V391A probably damaging Het
Syne2 A C 12: 75,949,301 (GRCm38) N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 (GRCm38) R481I possibly damaging Het
Tfam A G 10: 71,233,395 (GRCm38) S166P probably benign Het
Tmem63a A G 1: 180,956,491 (GRCm38) H212R probably benign Het
Txndc11 T A 16: 11,084,881 (GRCm38) Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 (GRCm38) probably benign Het
Vmn1r204 A T 13: 22,556,792 (GRCm38) M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 (GRCm38) T119S probably benign Het
Vsig1 A G X: 140,933,112 (GRCm38) D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 (GRCm38) P1102L probably benign Het
Zfp715 T C 7: 43,300,020 (GRCm38) Q172R probably benign Het
Zfp872 A G 9: 22,197,405 (GRCm38) D53G probably damaging Het
Zswim8 G A 14: 20,714,613 (GRCm38) D684N probably benign Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66,483,966 (GRCm38) missense probably benign 0.02
IGL00159:Herc1 APN 9 66,437,682 (GRCm38) missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66,476,120 (GRCm38) missense probably benign
IGL00717:Herc1 APN 9 66,485,002 (GRCm38) missense probably damaging 1.00
IGL00766:Herc1 APN 9 66,450,741 (GRCm38) missense probably damaging 1.00
IGL00776:Herc1 APN 9 66,421,038 (GRCm38) missense probably benign
IGL00987:Herc1 APN 9 66,408,052 (GRCm38) missense probably benign 0.07
IGL01090:Herc1 APN 9 66,469,175 (GRCm38) nonsense probably null
IGL01098:Herc1 APN 9 66,461,922 (GRCm38) critical splice donor site probably null
IGL01106:Herc1 APN 9 66,476,438 (GRCm38) splice site probably benign
IGL01120:Herc1 APN 9 66,428,880 (GRCm38) missense probably benign
IGL01359:Herc1 APN 9 66,439,268 (GRCm38) missense probably benign 0.01
IGL01360:Herc1 APN 9 66,483,699 (GRCm38) missense probably benign
IGL01364:Herc1 APN 9 66,399,361 (GRCm38) missense probably benign 0.00
IGL01470:Herc1 APN 9 66,497,636 (GRCm38) missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66,487,060 (GRCm38) missense probably damaging 1.00
IGL01825:Herc1 APN 9 66,399,807 (GRCm38) missense probably benign 0.00
IGL01903:Herc1 APN 9 66,386,872 (GRCm38) nonsense probably null
IGL01988:Herc1 APN 9 66,488,075 (GRCm38) splice site probably benign
IGL02074:Herc1 APN 9 66,450,983 (GRCm38) missense probably benign
IGL02089:Herc1 APN 9 66,480,869 (GRCm38) missense probably damaging 1.00
IGL02177:Herc1 APN 9 66,434,511 (GRCm38) missense probably benign
IGL02300:Herc1 APN 9 66,476,363 (GRCm38) missense probably benign 0.01
IGL02304:Herc1 APN 9 66,476,414 (GRCm38) missense probably benign 0.06
IGL02369:Herc1 APN 9 66,492,011 (GRCm38) nonsense probably null
IGL02445:Herc1 APN 9 66,433,482 (GRCm38) missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66,497,328 (GRCm38) missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66,399,901 (GRCm38) missense probably damaging 0.98
IGL02571:Herc1 APN 9 66,434,605 (GRCm38) splice site probably benign
IGL02709:Herc1 APN 9 66,497,680 (GRCm38) missense probably damaging 0.97
IGL02717:Herc1 APN 9 66,371,921 (GRCm38) nonsense probably null
IGL02726:Herc1 APN 9 66,441,988 (GRCm38) missense probably benign 0.37
IGL02733:Herc1 APN 9 66,450,992 (GRCm38) missense probably benign
IGL02963:Herc1 APN 9 66,388,823 (GRCm38) missense probably damaging 0.99
IGL03101:Herc1 APN 9 66,487,997 (GRCm38) missense probably benign
IGL03193:Herc1 APN 9 66,402,680 (GRCm38) missense probably benign
IGL03203:Herc1 APN 9 66,388,900 (GRCm38) critical splice donor site probably null
IGL03216:Herc1 APN 9 66,478,946 (GRCm38) missense probably benign 0.06
IGL03282:Herc1 APN 9 66,451,459 (GRCm38) missense probably benign 0.05
IGL03295:Herc1 APN 9 66,396,703 (GRCm38) missense possibly damaging 0.56
cradle UTSW 9 66,483,866 (GRCm38) splice site probably null
miracles UTSW 9 66,462,837 (GRCm38) nonsense probably null
newton UTSW 9 66,467,803 (GRCm38) missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66,433,428 (GRCm38) missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66,496,005 (GRCm38) missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66,486,126 (GRCm38) missense probably benign 0.03
stables UTSW 9 66,479,453 (GRCm38) missense probably benign 0.13
strangle UTSW 9 66,501,188 (GRCm38) frame shift probably null
IGL03134:Herc1 UTSW 9 66,434,063 (GRCm38) critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66,372,207 (GRCm38) missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66,372,389 (GRCm38) missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66,479,009 (GRCm38) missense probably damaging 1.00
R0044:Herc1 UTSW 9 66,448,175 (GRCm38) missense probably benign 0.04
R0044:Herc1 UTSW 9 66,448,175 (GRCm38) missense probably benign 0.04
R0052:Herc1 UTSW 9 66,400,156 (GRCm38) missense probably damaging 0.99
R0114:Herc1 UTSW 9 66,461,846 (GRCm38) missense probably damaging 0.99
R0129:Herc1 UTSW 9 66,448,075 (GRCm38) missense probably damaging 1.00
R0131:Herc1 UTSW 9 66,480,910 (GRCm38) missense probably benign 0.00
R0131:Herc1 UTSW 9 66,480,910 (GRCm38) missense probably benign 0.00
R0132:Herc1 UTSW 9 66,480,910 (GRCm38) missense probably benign 0.00
R0158:Herc1 UTSW 9 66,495,921 (GRCm38) nonsense probably null
R0333:Herc1 UTSW 9 66,464,699 (GRCm38) splice site probably null
R0384:Herc1 UTSW 9 66,481,050 (GRCm38) splice site probably benign
R0419:Herc1 UTSW 9 66,446,074 (GRCm38) splice site probably benign
R0453:Herc1 UTSW 9 66,399,772 (GRCm38) missense probably benign 0.20
R0458:Herc1 UTSW 9 66,476,381 (GRCm38) missense probably benign 0.12
R0490:Herc1 UTSW 9 66,484,999 (GRCm38) missense probably damaging 1.00
R0506:Herc1 UTSW 9 66,448,159 (GRCm38) missense probably damaging 0.99
R0513:Herc1 UTSW 9 66,445,645 (GRCm38) missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66,450,881 (GRCm38) missense probably benign 0.35
R0666:Herc1 UTSW 9 66,484,888 (GRCm38) splice site probably benign
R0674:Herc1 UTSW 9 66,501,192 (GRCm38) missense probably damaging 0.99
R0682:Herc1 UTSW 9 66,481,981 (GRCm38) missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66,386,838 (GRCm38) nonsense probably null
R0701:Herc1 UTSW 9 66,487,950 (GRCm38) missense probably damaging 1.00
R0766:Herc1 UTSW 9 66,504,840 (GRCm38) missense probably damaging 1.00
R0850:Herc1 UTSW 9 66,466,670 (GRCm38) missense probably damaging 1.00
R0907:Herc1 UTSW 9 66,433,428 (GRCm38) missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66,372,145 (GRCm38) missense probably damaging 1.00
R0976:Herc1 UTSW 9 66,439,878 (GRCm38) missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66,455,968 (GRCm38) missense probably benign
R1200:Herc1 UTSW 9 66,486,124 (GRCm38) missense probably damaging 1.00
R1226:Herc1 UTSW 9 66,416,263 (GRCm38) missense probably benign 0.00
R1364:Herc1 UTSW 9 66,400,093 (GRCm38) missense probably damaging 1.00
R1395:Herc1 UTSW 9 66,439,181 (GRCm38) missense probably benign 0.13
R1432:Herc1 UTSW 9 66,465,469 (GRCm38) missense probably benign 0.13
R1440:Herc1 UTSW 9 66,467,803 (GRCm38) missense probably damaging 1.00
R1476:Herc1 UTSW 9 66,508,266 (GRCm38) missense probably damaging 1.00
R1590:Herc1 UTSW 9 66,491,953 (GRCm38) splice site probably benign
R1634:Herc1 UTSW 9 66,473,538 (GRCm38) missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66,450,678 (GRCm38) splice site probably null
R1753:Herc1 UTSW 9 66,502,084 (GRCm38) critical splice donor site probably null
R1753:Herc1 UTSW 9 66,469,010 (GRCm38) missense probably damaging 1.00
R1796:Herc1 UTSW 9 66,388,856 (GRCm38) nonsense probably null
R1830:Herc1 UTSW 9 66,497,599 (GRCm38) missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66,391,426 (GRCm38) missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66,450,791 (GRCm38) missense probably damaging 1.00
R1894:Herc1 UTSW 9 66,479,461 (GRCm38) missense probably damaging 1.00
R1918:Herc1 UTSW 9 66,476,126 (GRCm38) splice site probably null
R1999:Herc1 UTSW 9 66,486,078 (GRCm38) missense probably benign 0.07
R2034:Herc1 UTSW 9 66,441,972 (GRCm38) missense probably benign 0.01
R2138:Herc1 UTSW 9 66,470,307 (GRCm38) missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66,439,901 (GRCm38) missense probably benign 0.45
R2192:Herc1 UTSW 9 66,465,406 (GRCm38) missense probably damaging 0.99
R2312:Herc1 UTSW 9 66,508,281 (GRCm38) nonsense probably null
R2338:Herc1 UTSW 9 66,428,969 (GRCm38) missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66,483,935 (GRCm38) missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66,445,640 (GRCm38) missense probably damaging 1.00
R3732:Herc1 UTSW 9 66,445,640 (GRCm38) missense probably damaging 1.00
R3733:Herc1 UTSW 9 66,445,640 (GRCm38) missense probably damaging 1.00
R3917:Herc1 UTSW 9 66,434,466 (GRCm38) missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66,433,793 (GRCm38) nonsense probably null
R4073:Herc1 UTSW 9 66,418,492 (GRCm38) missense probably benign 0.12
R4075:Herc1 UTSW 9 66,418,492 (GRCm38) missense probably benign 0.12
R4241:Herc1 UTSW 9 66,448,348 (GRCm38) frame shift probably null
R4260:Herc1 UTSW 9 66,448,348 (GRCm38) frame shift probably null
R4261:Herc1 UTSW 9 66,448,348 (GRCm38) frame shift probably null
R4300:Herc1 UTSW 9 66,489,406 (GRCm38) missense probably damaging 1.00
R4398:Herc1 UTSW 9 66,479,453 (GRCm38) missense probably benign 0.13
R4426:Herc1 UTSW 9 66,496,005 (GRCm38) missense probably damaging 1.00
R4427:Herc1 UTSW 9 66,496,005 (GRCm38) missense probably damaging 1.00
R4590:Herc1 UTSW 9 66,437,664 (GRCm38) missense probably damaging 0.97
R4630:Herc1 UTSW 9 66,433,714 (GRCm38) splice site probably null
R4656:Herc1 UTSW 9 66,394,711 (GRCm38) missense probably damaging 0.97
R4658:Herc1 UTSW 9 66,479,491 (GRCm38) missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66,433,378 (GRCm38) missense probably damaging 0.98
R4678:Herc1 UTSW 9 66,416,269 (GRCm38) missense probably benign 0.00
R4754:Herc1 UTSW 9 66,501,206 (GRCm38) missense probably benign 0.00
R4766:Herc1 UTSW 9 66,441,929 (GRCm38) missense probably benign 0.00
R4792:Herc1 UTSW 9 66,495,984 (GRCm38) missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66,497,343 (GRCm38) splice site probably null
R4832:Herc1 UTSW 9 66,495,971 (GRCm38) missense probably benign 0.11
R4879:Herc1 UTSW 9 66,462,837 (GRCm38) nonsense probably null
R4948:Herc1 UTSW 9 66,484,902 (GRCm38) missense probably benign
R5021:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66,486,126 (GRCm38) missense probably benign 0.03
R5027:Herc1 UTSW 9 66,473,529 (GRCm38) missense probably benign 0.01
R5027:Herc1 UTSW 9 66,504,618 (GRCm38) missense probably damaging 0.98
R5038:Herc1 UTSW 9 66,476,460 (GRCm38) intron probably benign
R5041:Herc1 UTSW 9 66,429,045 (GRCm38) missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66,470,326 (GRCm38) missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66,448,223 (GRCm38) missense probably benign
R5197:Herc1 UTSW 9 66,448,504 (GRCm38) missense probably damaging 0.99
R5207:Herc1 UTSW 9 66,399,869 (GRCm38) nonsense probably null
R5247:Herc1 UTSW 9 66,434,551 (GRCm38) missense probably benign 0.01
R5267:Herc1 UTSW 9 66,461,809 (GRCm38) missense probably damaging 1.00
R5274:Herc1 UTSW 9 66,399,409 (GRCm38) missense probably benign
R5375:Herc1 UTSW 9 66,467,887 (GRCm38) missense probably damaging 0.99
R5401:Herc1 UTSW 9 66,502,056 (GRCm38) missense probably damaging 1.00
R5560:Herc1 UTSW 9 66,451,119 (GRCm38) missense probably benign 0.02
R5566:Herc1 UTSW 9 66,465,537 (GRCm38) missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66,481,981 (GRCm38) missense probably damaging 0.99
R5596:Herc1 UTSW 9 66,434,063 (GRCm38) critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66,465,435 (GRCm38) missense probably damaging 1.00
R5744:Herc1 UTSW 9 66,508,193 (GRCm38) missense probably damaging 1.00
R5802:Herc1 UTSW 9 66,462,878 (GRCm38) missense probably damaging 1.00
R5822:Herc1 UTSW 9 66,445,612 (GRCm38) missense probably benign 0.00
R5954:Herc1 UTSW 9 66,451,492 (GRCm38) splice site probably benign
R5977:Herc1 UTSW 9 66,433,322 (GRCm38) missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66,483,685 (GRCm38) missense probably damaging 1.00
R6043:Herc1 UTSW 9 66,408,154 (GRCm38) missense probably benign
R6046:Herc1 UTSW 9 66,445,549 (GRCm38) missense probably damaging 0.99
R6089:Herc1 UTSW 9 66,445,532 (GRCm38) missense probably damaging 1.00
R6123:Herc1 UTSW 9 66,497,250 (GRCm38) missense probably damaging 0.97
R6155:Herc1 UTSW 9 66,433,423 (GRCm38) missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66,376,381 (GRCm38) missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66,433,788 (GRCm38) missense probably damaging 1.00
R6265:Herc1 UTSW 9 66,372,016 (GRCm38) missense probably benign 0.05
R6348:Herc1 UTSW 9 66,487,976 (GRCm38) missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66,471,908 (GRCm38) missense probably damaging 1.00
R6394:Herc1 UTSW 9 66,395,059 (GRCm38) missense probably damaging 0.99
R6434:Herc1 UTSW 9 66,486,182 (GRCm38) missense probably damaging 0.99
R6483:Herc1 UTSW 9 66,448,529 (GRCm38) missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66,418,567 (GRCm38) missense probably benign 0.02
R6633:Herc1 UTSW 9 66,439,252 (GRCm38) nonsense probably null
R6634:Herc1 UTSW 9 66,437,744 (GRCm38) missense probably benign
R6693:Herc1 UTSW 9 66,478,976 (GRCm38) missense probably damaging 0.99
R6695:Herc1 UTSW 9 66,483,866 (GRCm38) splice site probably null
R6748:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6750:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6751:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6774:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6785:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6786:Herc1 UTSW 9 66,501,188 (GRCm38) frame shift probably null
R6856:Herc1 UTSW 9 66,397,898 (GRCm38) missense probably benign 0.05
R6966:Herc1 UTSW 9 66,411,065 (GRCm38) missense probably benign 0.07
R7020:Herc1 UTSW 9 66,486,078 (GRCm38) missense probably benign 0.07
R7109:Herc1 UTSW 9 66,481,889 (GRCm38) missense probably benign 0.03
R7122:Herc1 UTSW 9 66,399,774 (GRCm38) missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66,385,032 (GRCm38) missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66,467,499 (GRCm38) missense probably damaging 0.98
R7303:Herc1 UTSW 9 66,450,816 (GRCm38) missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66,461,868 (GRCm38) missense
R7438:Herc1 UTSW 9 66,394,756 (GRCm38) missense probably benign 0.00
R7535:Herc1 UTSW 9 66,474,853 (GRCm38) missense probably damaging 1.00
R7585:Herc1 UTSW 9 66,445,547 (GRCm38) missense probably damaging 1.00
R7603:Herc1 UTSW 9 66,451,383 (GRCm38) nonsense probably null
R7670:Herc1 UTSW 9 66,416,347 (GRCm38) missense probably damaging 0.99
R7705:Herc1 UTSW 9 66,439,834 (GRCm38) missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66,371,876 (GRCm38) missense probably benign 0.24
R7730:Herc1 UTSW 9 66,493,190 (GRCm38) small deletion probably benign
R7880:Herc1 UTSW 9 66,508,224 (GRCm38) missense probably damaging 0.99
R7958:Herc1 UTSW 9 66,486,193 (GRCm38) missense probably damaging 1.00
R7976:Herc1 UTSW 9 66,434,270 (GRCm38) missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66,445,560 (GRCm38) nonsense probably null
R8084:Herc1 UTSW 9 66,475,935 (GRCm38) missense probably benign 0.45
R8094:Herc1 UTSW 9 66,493,180 (GRCm38) missense probably damaging 0.98
R8099:Herc1 UTSW 9 66,372,140 (GRCm38) missense probably damaging 1.00
R8151:Herc1 UTSW 9 66,433,791 (GRCm38) missense probably damaging 0.98
R8159:Herc1 UTSW 9 66,461,721 (GRCm38) missense probably null
R8190:Herc1 UTSW 9 66,418,451 (GRCm38) missense probably benign 0.00
R8213:Herc1 UTSW 9 66,450,888 (GRCm38) missense probably damaging 0.99
R8230:Herc1 UTSW 9 66,470,316 (GRCm38) missense probably damaging 0.99
R8265:Herc1 UTSW 9 66,386,704 (GRCm38) nonsense probably null
R8270:Herc1 UTSW 9 66,487,950 (GRCm38) missense probably damaging 1.00
R8353:Herc1 UTSW 9 66,508,289 (GRCm38) missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66,508,160 (GRCm38) missense probably damaging 0.99
R8506:Herc1 UTSW 9 66,473,581 (GRCm38) missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66,450,942 (GRCm38) missense probably benign
R8530:Herc1 UTSW 9 66,418,628 (GRCm38) missense probably benign
R8545:Herc1 UTSW 9 66,371,975 (GRCm38) nonsense probably null
R8682:Herc1 UTSW 9 66,462,848 (GRCm38) missense
R8720:Herc1 UTSW 9 66,481,823 (GRCm38) missense probably benign 0.38
R8792:Herc1 UTSW 9 66,465,486 (GRCm38) missense probably damaging 1.00
R8915:Herc1 UTSW 9 66,411,174 (GRCm38) missense probably damaging 1.00
R8964:Herc1 UTSW 9 66,445,590 (GRCm38) missense probably damaging 1.00
R9056:Herc1 UTSW 9 66,473,500 (GRCm38) missense probably benign 0.10
R9158:Herc1 UTSW 9 66,469,118 (GRCm38) missense probably benign 0.00
R9167:Herc1 UTSW 9 66,504,618 (GRCm38) missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66,414,131 (GRCm38) missense probably benign 0.35
R9252:Herc1 UTSW 9 66,402,552 (GRCm38) missense probably damaging 1.00
R9260:Herc1 UTSW 9 66,418,409 (GRCm38) nonsense probably null
R9261:Herc1 UTSW 9 66,504,847 (GRCm38) missense probably damaging 0.98
R9430:Herc1 UTSW 9 66,418,503 (GRCm38) nonsense probably null
R9519:Herc1 UTSW 9 66,400,074 (GRCm38) missense probably damaging 0.97
R9563:Herc1 UTSW 9 66,386,911 (GRCm38) critical splice donor site probably null
R9589:Herc1 UTSW 9 66,465,558 (GRCm38) missense possibly damaging 0.95
R9600:Herc1 UTSW 9 66,397,312 (GRCm38) missense possibly damaging 0.95
R9659:Herc1 UTSW 9 66,399,903 (GRCm38) missense probably benign 0.03
R9740:Herc1 UTSW 9 66,448,514 (GRCm38) missense probably damaging 1.00
R9774:Herc1 UTSW 9 66,464,750 (GRCm38) missense probably null
R9781:Herc1 UTSW 9 66,372,722 (GRCm38) missense probably benign
R9788:Herc1 UTSW 9 66,399,903 (GRCm38) missense probably benign 0.03
RF023:Herc1 UTSW 9 66,458,334 (GRCm38) missense
X0011:Herc1 UTSW 9 66,400,159 (GRCm38) missense probably benign 0.28
X0067:Herc1 UTSW 9 66,448,524 (GRCm38) missense probably benign 0.03
Z1176:Herc1 UTSW 9 66,434,576 (GRCm38) missense probably benign
Z1177:Herc1 UTSW 9 66,471,911 (GRCm38) missense probably damaging 0.99
Z1177:Herc1 UTSW 9 66,458,425 (GRCm38) missense probably null
Predicted Primers PCR Primer
(F):5'- GAAGAATGGACTTAAGTTGCCTAAC -3'
(R):5'- TAAGAAAACCTGGCTCATCTTCATC -3'

Sequencing Primer
(F):5'- CCATGGTGATACCAACAG -3'
(R):5'- AGCTTTTATCACAGCCCTTAGGAGG -3'
Posted On 2015-10-08