Incidental Mutation 'R4675:Slc47a1'
ID349513
Institutional Source Beutler Lab
Gene Symbol Slc47a1
Ensembl Gene ENSMUSG00000010122
Gene Namesolute carrier family 47, member 1
SynonymsmMATE1, 1300013J15Rik, MATE1
MMRRC Submission 041930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4675 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61343401-61378345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61363031 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 194 (T194I)
Ref Sequence ENSEMBL: ENSMUSP00000118265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000131723] [ENSMUST00000148671]
Predicted Effect probably benign
Transcript: ENSMUST00000010267
AA Change: T244I

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: T244I

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131723
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147583
Predicted Effect probably benign
Transcript: ENSMUST00000148671
AA Change: T194I

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118265
Gene: ENSMUSG00000010122
AA Change: T194I

DomainStartEndE-ValueType
Pfam:MatE 1 154 4.5e-30 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Meta Mutation Damage Score 0.8545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased blood urea nitrogen, increased circulating creatinine, and abnormal metformin pahrmacokinetics including increased plasma and tissue concentration with decreased kidney and liver clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,144,448 D133G probably benign Het
2310061I04Rik C A 17: 35,892,928 K291N probably damaging Het
Adgra1 A G 7: 139,876,186 T577A probably damaging Het
Akip1 T A 7: 109,708,981 I152N possibly damaging Het
Armc9 A G 1: 86,202,518 Y8C probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Atp2a3 A T 11: 72,981,797 T724S probably damaging Het
Bmp1 C A 14: 70,492,844 R416L probably damaging Het
Bmt2 G T 6: 13,663,301 A66E probably benign Het
Bscl2 A T 19: 8,848,159 D403V possibly damaging Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Cntnap4 A G 8: 112,785,836 Y610C probably damaging Het
Col11a2 T C 17: 34,064,293 probably null Het
Col17a1 T C 19: 47,663,058 probably null Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Dgkz T A 2: 91,938,346 K697* probably null Het
Dnah7b T A 1: 46,217,157 D1873E possibly damaging Het
Dst G A 1: 34,275,703 E6472K possibly damaging Het
Duox2 T C 2: 122,280,933 D1428G probably damaging Het
Elmod2 T C 8: 83,316,908 N210S probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fbn2 T A 18: 58,040,193 N2051I possibly damaging Het
Gabrg2 G A 11: 41,968,823 H201Y probably damaging Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 S167P probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
Gm281 A T 14: 13,856,724 D462E probably benign Het
Heatr5a T C 12: 51,877,347 N2028D probably benign Het
Heca T C 10: 17,915,309 H333R probably benign Het
Herc1 T C 9: 66,391,458 S625P probably damaging Het
Ighv1-55 T C 12: 115,208,555 probably benign Het
Ighv5-8 G A 12: 113,655,157 S64N probably benign Het
Itga1 G T 13: 115,001,691 probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Ksr1 G A 11: 79,074,360 P118S possibly damaging Het
Lat2 T C 5: 134,606,057 N100S probably damaging Het
Lrit3 T A 3: 129,788,472 D501V probably damaging Het
Lrrfip1 T A 1: 91,103,320 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Med21 T A 6: 146,650,193 L114H probably damaging Het
Mfap4 A T 11: 61,485,510 probably benign Het
Mpdz G A 4: 81,383,812 R233W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncapd3 T C 9: 27,094,742 probably benign Het
Neto2 T G 8: 85,669,704 H104P probably damaging Het
Nr1h2 T C 7: 44,552,555 T36A possibly damaging Het
Olfr1252 T C 2: 89,721,494 I206V probably benign Het
Olfr472 A G 7: 107,903,360 I214M probably damaging Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr53 A T 7: 140,652,161 M61L probably damaging Het
Olfr577 A G 7: 102,973,806 M62T probably damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Olfr878 T C 9: 37,919,586 *310R probably null Het
Pcbp3 A G 10: 76,771,035 L241S possibly damaging Het
Pcf11 G A 7: 92,659,777 probably benign Het
Podxl G A 6: 31,526,644 T254M possibly damaging Het
Prr27 A C 5: 87,843,241 E237D possibly damaging Het
Rdh16 G T 10: 127,801,447 V84F probably damaging Het
Rnf26 A T 9: 44,112,131 D273E probably benign Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rpl3l A G 17: 24,733,610 K239E probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Ryk A G 9: 102,891,216 D352G possibly damaging Het
Setd1b T A 5: 123,160,998 probably benign Het
Sh2b1 G A 7: 126,471,446 A361V possibly damaging Het
Slc35f3 A T 8: 126,321,196 K92* probably null Het
Slc39a10 A G 1: 46,817,984 probably benign Het
Slc6a3 C A 13: 73,544,817 N185K probably damaging Het
Stag1 T C 9: 100,848,705 V391A probably damaging Het
Syne2 A C 12: 75,949,301 N2206T probably damaging Het
Tbc1d23 C A 16: 57,182,962 R481I possibly damaging Het
Tfam A G 10: 71,233,395 S166P probably benign Het
Tmem63a A G 1: 180,956,491 H212R probably benign Het
Txndc11 T A 16: 11,084,881 Q634L possibly damaging Het
Usp31 T C 7: 121,707,325 probably benign Het
Vmn1r204 A T 13: 22,556,792 M198L probably damaging Het
Vmn2r17 A T 5: 109,427,183 T119S probably benign Het
Vsig1 A G X: 140,933,112 D227G probably damaging Het
Zfhx2 G A 14: 55,067,221 P1102L probably benign Het
Zfp715 T C 7: 43,300,020 Q172R probably benign Het
Zfp872 A G 9: 22,197,405 D53G probably damaging Het
Zswim8 G A 14: 20,714,613 D684N probably benign Het
Other mutations in Slc47a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Slc47a1 APN 11 61370124 missense probably damaging 1.00
IGL02399:Slc47a1 APN 11 61363058 missense probably damaging 1.00
IGL02586:Slc47a1 APN 11 61344321 missense probably benign 0.14
IGL02832:Slc47a1 APN 11 61363413 missense probably benign 0.01
IGL02873:Slc47a1 APN 11 61362817 unclassified probably benign
IGL03038:Slc47a1 APN 11 61353092 missense probably benign 0.14
R0392:Slc47a1 UTSW 11 61371782 missense probably damaging 1.00
R0927:Slc47a1 UTSW 11 61373422 missense probably damaging 0.96
R1255:Slc47a1 UTSW 11 61370148 missense probably damaging 1.00
R1507:Slc47a1 UTSW 11 61359518 critical splice donor site probably null
R1625:Slc47a1 UTSW 11 61371799 missense probably damaging 1.00
R2029:Slc47a1 UTSW 11 61378007 intron probably benign
R2137:Slc47a1 UTSW 11 61344492 missense probably benign 0.21
R2434:Slc47a1 UTSW 11 61367722 splice site probably null
R3115:Slc47a1 UTSW 11 61367680 missense possibly damaging 0.88
R3752:Slc47a1 UTSW 11 61344381 missense possibly damaging 0.84
R3839:Slc47a1 UTSW 11 61353058 splice site probably benign
R4499:Slc47a1 UTSW 11 61359529 missense probably benign
R4516:Slc47a1 UTSW 11 61344513 missense probably benign
R4727:Slc47a1 UTSW 11 61363451 missense possibly damaging 0.48
R4839:Slc47a1 UTSW 11 61373350 splice site probably null
R4869:Slc47a1 UTSW 11 61362694 missense probably benign 0.02
R5164:Slc47a1 UTSW 11 61353060 splice site probably null
R5633:Slc47a1 UTSW 11 61369261 missense probably damaging 1.00
R5957:Slc47a1 UTSW 11 61344342 missense probably benign 0.06
R6793:Slc47a1 UTSW 11 61359403 missense probably benign
R6952:Slc47a1 UTSW 11 61344454 missense probably benign 0.04
R7082:Slc47a1 UTSW 11 61377941 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTCATCCATCTGCATACGTAC -3'
(R):5'- TGAAGGGTACATGGCTTCCC -3'

Sequencing Primer
(F):5'- GGAAGCTGCCAACCTCATAGG -3'
(R):5'- AGGGTACATGGCTTCCCAACTC -3'
Posted On2015-10-08