Incidental Mutation 'R4675:Bmp1'
ID 349529
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 041930-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4675 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70730284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 416 (R416L)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: R416L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: R416L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226601
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Meta Mutation Damage Score 0.6210 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C A 17: 36,203,820 (GRCm39) K291N probably damaging Het
Adgra1 A G 7: 139,456,102 (GRCm39) T577A probably damaging Het
Akip1 T A 7: 109,308,188 (GRCm39) I152N possibly damaging Het
Armc9 A G 1: 86,130,240 (GRCm39) Y8C probably damaging Het
Atp1a4 A T 1: 172,085,223 (GRCm39) V66E possibly damaging Het
Atp2a3 A T 11: 72,872,623 (GRCm39) T724S probably damaging Het
Bmt2 G T 6: 13,663,300 (GRCm39) A66E probably benign Het
Bscl2 A T 19: 8,825,523 (GRCm39) D403V possibly damaging Het
Cbx2 T A 11: 118,919,935 (GRCm39) I500N probably damaging Het
Cd84 A T 1: 171,700,887 (GRCm39) H216L possibly damaging Het
Cdhr18 A T 14: 13,856,724 (GRCm38) D462E probably benign Het
Ceacam15 T C 7: 16,407,410 (GRCm39) T36A probably benign Het
Cebpd A G 16: 15,705,385 (GRCm39) D66G probably damaging Het
Cntnap4 A G 8: 113,512,468 (GRCm39) Y610C probably damaging Het
Col11a2 T C 17: 34,283,267 (GRCm39) probably null Het
Col17a1 T C 19: 47,651,497 (GRCm39) probably null Het
Cracr2b A G 7: 141,043,451 (GRCm39) D43G probably damaging Het
Dgkz T A 2: 91,768,691 (GRCm39) K697* probably null Het
Dnah7b T A 1: 46,256,317 (GRCm39) D1873E possibly damaging Het
Dst G A 1: 34,314,784 (GRCm39) E6472K possibly damaging Het
Duox2 T C 2: 122,111,414 (GRCm39) D1428G probably damaging Het
Elmod2 T C 8: 84,043,537 (GRCm39) N210S probably damaging Het
Ephx1 A G 1: 180,822,256 (GRCm39) F220S probably damaging Het
F13b A G 1: 139,429,542 (GRCm39) Y20C unknown Het
Fbn2 T A 18: 58,173,265 (GRCm39) N2051I possibly damaging Het
Gabrg2 G A 11: 41,859,650 (GRCm39) H201Y probably damaging Het
Gbgt1 T C 2: 28,388,453 (GRCm39) F46S possibly damaging Het
Gjd4 A G 18: 9,280,578 (GRCm39) S167P probably damaging Het
Heatr5a T C 12: 51,924,130 (GRCm39) N2028D probably benign Het
Heca T C 10: 17,791,057 (GRCm39) H333R probably benign Het
Herc1 T C 9: 66,298,740 (GRCm39) S625P probably damaging Het
Ighv1-55 T C 12: 115,172,175 (GRCm39) probably benign Het
Ighv5-8 G A 12: 113,618,777 (GRCm39) S64N probably benign Het
Itga1 G T 13: 115,138,227 (GRCm39) probably null Het
Kif21a C A 15: 90,824,748 (GRCm39) R1342L possibly damaging Het
Ksr1 G A 11: 78,965,186 (GRCm39) P118S possibly damaging Het
Lat2 T C 5: 134,634,911 (GRCm39) N100S probably damaging Het
Lrit3 T A 3: 129,582,121 (GRCm39) D501V probably damaging Het
Lrrfip1 T A 1: 91,031,042 (GRCm39) probably null Het
Lyst G A 13: 13,809,968 (GRCm39) R546H probably damaging Het
Med21 T A 6: 146,551,691 (GRCm39) L114H probably damaging Het
Mfap4 A T 11: 61,376,336 (GRCm39) probably benign Het
Mpdz G A 4: 81,302,049 (GRCm39) R233W probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Ncapd3 T C 9: 27,006,038 (GRCm39) probably benign Het
Neto2 T G 8: 86,396,333 (GRCm39) H104P probably damaging Het
Nr1h2 T C 7: 44,201,979 (GRCm39) T36A possibly damaging Het
Nudt16l2 T C 9: 105,021,647 (GRCm39) D133G probably benign Het
Or13a20 A T 7: 140,232,074 (GRCm39) M61L probably damaging Het
Or4a79 T C 2: 89,551,838 (GRCm39) I206V probably benign Het
Or51ab3 T G 7: 103,201,183 (GRCm39) L64V probably damaging Het
Or51g2 A G 7: 102,623,013 (GRCm39) M62T probably damaging Het
Or52p1 T A 7: 104,267,631 (GRCm39) C248* probably null Het
Or5p52 A G 7: 107,502,567 (GRCm39) I214M probably damaging Het
Or5p72 T C 7: 108,022,309 (GRCm39) V177A possibly damaging Het
Or8b4 T C 9: 37,830,882 (GRCm39) *310R probably null Het
Pcbp3 A G 10: 76,606,869 (GRCm39) L241S possibly damaging Het
Pcf11 G A 7: 92,308,985 (GRCm39) probably benign Het
Podxl G A 6: 31,503,579 (GRCm39) T254M possibly damaging Het
Prr27 A C 5: 87,991,100 (GRCm39) E237D possibly damaging Het
Rdh16 G T 10: 127,637,316 (GRCm39) V84F probably damaging Het
Rnf26 A T 9: 44,023,428 (GRCm39) D273E probably benign Het
Rpl13a A T 7: 44,776,242 (GRCm39) probably benign Het
Rpl3l A G 17: 24,952,584 (GRCm39) K239E probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Rsf1 A AGGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Ryk A G 9: 102,768,415 (GRCm39) D352G possibly damaging Het
Setd1b T A 5: 123,299,061 (GRCm39) probably benign Het
Sh2b1 G A 7: 126,070,618 (GRCm39) A361V possibly damaging Het
Slc35f3 A T 8: 127,047,935 (GRCm39) K92* probably null Het
Slc39a10 A G 1: 46,857,144 (GRCm39) probably benign Het
Slc47a1 G A 11: 61,253,857 (GRCm39) T194I probably benign Het
Slc6a3 C A 13: 73,692,936 (GRCm39) N185K probably damaging Het
Stag1 T C 9: 100,730,758 (GRCm39) V391A probably damaging Het
Syne2 A C 12: 75,996,075 (GRCm39) N2206T probably damaging Het
Tbc1d23 C A 16: 57,003,325 (GRCm39) R481I possibly damaging Het
Tcstv7b T C 13: 120,702,362 (GRCm39) W53R probably damaging Het
Tfam A G 10: 71,069,225 (GRCm39) S166P probably benign Het
Tmem63a A G 1: 180,784,056 (GRCm39) H212R probably benign Het
Txndc11 T A 16: 10,902,745 (GRCm39) Q634L possibly damaging Het
Usp31 T C 7: 121,306,548 (GRCm39) probably benign Het
Vmn1r204 A T 13: 22,740,962 (GRCm39) M198L probably damaging Het
Vmn2r17 A T 5: 109,575,049 (GRCm39) T119S probably benign Het
Vsig1 A G X: 139,833,861 (GRCm39) D227G probably damaging Het
Zfhx2 G A 14: 55,304,678 (GRCm39) P1102L probably benign Het
Zfp715 T C 7: 42,949,444 (GRCm39) Q172R probably benign Het
Zfp872 A G 9: 22,108,701 (GRCm39) D53G probably damaging Het
Zswim8 G A 14: 20,764,681 (GRCm39) D684N probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGCCCATGAGTAAG -3'
(R):5'- ACACACATGTCCTTCAGCTC -3'

Sequencing Primer
(F):5'- ATGAGTAAGGGCCCCTTCC -3'
(R):5'- CCTGCCCTGTCTCTTAAAGGG -3'
Posted On 2015-10-08