Incidental Mutation 'R4676:Atf6'
ID 349545
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 170614979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 538 (Y538C)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: Y538C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Y538C

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182787
Meta Mutation Damage Score 0.7317 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R0784:Atf6 UTSW 1 170,537,516 (GRCm39) missense probably benign 0.19
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1850:Atf6 UTSW 1 170,646,855 (GRCm39) missense probably damaging 1.00
R1945:Atf6 UTSW 1 170,682,710 (GRCm39) missense probably benign 0.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4631:Atf6 UTSW 1 170,574,766 (GRCm39) splice site probably null
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6242:Atf6 UTSW 1 170,621,545 (GRCm39) missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTCTCACCGCACAGTCC -3'
(R):5'- GTTAAAATGCTACCCTTTCGACTG -3'

Sequencing Primer
(F):5'- GCATCAGTGCCATGCTCCTG -3'
(R):5'- CGACTGAAAGTTGTTCTTGAGATTC -3'
Posted On 2015-10-08