Incidental Mutation 'R4676:Atf6'
ID 349545
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 170787410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 538 (Y538C)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: Y538C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Y538C

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182787
Meta Mutation Damage Score 0.7317 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
R9500:Atf6 UTSW 1 170747139 missense probably damaging 0.98
R9594:Atf6 UTSW 1 170840833 missense probably benign 0.18
R9733:Atf6 UTSW 1 170834833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTCTCACCGCACAGTCC -3'
(R):5'- GTTAAAATGCTACCCTTTCGACTG -3'

Sequencing Primer
(F):5'- GCATCAGTGCCATGCTCCTG -3'
(R):5'- CGACTGAAAGTTGTTCTTGAGATTC -3'
Posted On 2015-10-08