Mutagenetix > Incidental Mutations

Incidental Mutation 'R4676:Itch'

349549

Institutional Source

Beutler Lab

Gene Symbol

Itch

Ensembl Gene

ENSMUSG00000027598

Gene Name

itchy, E3 ubiquitin protein ligase

Synonyms

8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4

MMRRC Submission

042013-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4676 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155133509-155226855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 155199435 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 468 (I468L)

Ref Sequence

ENSEMBL: ENSMUSP00000105307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]

Predicted Effect

probably benign
Transcript: ENSMUST00000029126
AA Change: I468L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: I468L

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109685
AA Change: I468L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: I468L

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119431

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142147

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	T	A	1: 120,150,652	I13N	probably damaging	Het
Abcd3	T	A	3: 121,774,166	T409S	possibly damaging	Het
Acad12	C	A	5: 121,607,171	W317L	probably damaging	Het
Acap1	T	A	11: 69,889,468	M50L	probably benign	Het
Acvr1b	T	A	15: 101,202,986	V343E	probably damaging	Het
Adgb	C	A	10: 10,426,710	G371W	probably damaging	Het
AF529169	A	G	9: 89,601,553	V597A	probably damaging	Het
Akap9	A	G	5: 4,032,774	K1966R	probably damaging	Het
Akap9	C	T	5: 4,064,515	Q48*	probably null	Het
Ano10	T	C	9: 122,263,787	R159G	probably damaging	Het
Anxa7	T	C	14: 20,467,915	M128V	probably benign	Het
Arhgef40	C	A	14: 51,990,959	C554*	probably null	Het
Asna1	C	T	8: 85,018,873	A219T	probably benign	Het
Atf6	T	C	1: 170,787,410	Y538C	probably damaging	Het
Atp8b1	A	C	18: 64,538,678	D1091E	probably benign	Het
BC034090	A	G	1: 155,226,264	Y85H	possibly damaging	Het
BC067074	C	A	13: 113,368,807	L2157I	probably damaging	Het
BC067074	T	G	13: 113,368,808	L2157R	probably damaging	Het
Bcas2	A	G	3: 103,175,701		probably benign	Het
Bnc2	T	C	4: 84,292,819	N463D	probably damaging	Het
Capn7	A	T	14: 31,359,259	H411L	possibly damaging	Het
Cavin3	T	C	7: 105,481,113	E164G	probably damaging	Het
Ccdc191	T	C	16: 43,939,173		probably benign	Het
Ccdc88b	A	G	19: 6,853,000	V858A	probably benign	Het
Clcn3	A	G	8: 60,930,651		probably benign	Het
Commd6	T	C	14: 101,640,284		probably benign	Het
Cul3	G	A	1: 80,271,674	L561F	probably damaging	Het
Cyfip1	T	A	7: 55,875,013	I131N	probably damaging	Het
Dlgap3	T	A	4: 127,233,761	Y741N	probably damaging	Het
Dnah5	A	T	15: 28,295,260	I1380F	possibly damaging	Het
Dync1h1	G	T	12: 110,662,541	L4177F	probably damaging	Het
Ethe1	G	A	7: 24,607,894	V178M	probably damaging	Het
Flnc	A	T	6: 29,445,154		probably null	Het
Glt8d1	T	C	14: 31,006,692	F26L	probably benign	Het
Gm5493	T	A	17: 22,748,081	D63E	probably benign	Het
Gm9996	T	A	10: 29,143,838		probably benign	Het
Gnl2	T	G	4: 125,053,473	S629R	possibly damaging	Het
Gpbp1l1	T	C	4: 116,590,265	S381P	probably damaging	Het
Igsf10	A	C	3: 59,325,949	F1788V	probably benign	Het
Inpp5d	C	A	1: 87,715,142	P935Q	probably damaging	Het
Itga5	A	T	15: 103,357,210	Y192N	probably damaging	Het
Itih3	T	A	14: 30,918,949	Q302L	probably null	Het
Itih3	T	A	14: 30,921,686	Q121L	possibly damaging	Het
Kctd17	T	A	15: 78,435,759		probably benign	Het
Lsm1	T	C	8: 25,793,689	L43P	probably damaging	Het
Magi3	A	T	3: 104,015,825	M1192K	probably benign	Het
Mecom	A	G	3: 30,268,668		probably benign	Het
Mtmr3	A	T	11: 4,527,855	F63Y	probably benign	Het
Naa16	A	G	14: 79,336,348		probably benign	Het
Neto1	A	T	18: 86,398,302	T45S	possibly damaging	Het
Nlrp4a	A	T	7: 26,450,229	R420S	probably damaging	Het
Nr1h4	T	C	10: 89,473,874	D317G	probably damaging	Het
Olfr1497	T	A	19: 13,795,474	I46F	possibly damaging	Het
Olfr1504	C	T	19: 13,887,401	D270N	probably damaging	Het
Olfr920	A	G	9: 38,755,659		probably benign	Het
Pde5a	A	T	3: 122,747,893	M11L	possibly damaging	Het
Plxnb1	G	A	9: 109,110,435	R1416Q	possibly damaging	Het
Polm	A	T	11: 5,835,749	Y141*	probably null	Het
Rxfp1	A	G	3: 79,705,668	F32L	probably damaging	Het
Scrt1	T	A	15: 76,521,668	D13V	possibly damaging	Het
Slc1a7	T	A	4: 107,977,674	V79E	possibly damaging	Het
Snurf	T	C	7: 59,995,522	Q48R	probably benign	Het
Srek1	T	C	13: 103,758,187		probably benign	Het
Stxbp5l	T	C	16: 37,255,884	S267G	probably damaging	Het
Taf5	C	T	19: 47,074,970	R320W	probably damaging	Het
Tars2	A	T	3: 95,753,091	N106K	probably damaging	Het
Tatdn3	A	T	1: 191,049,334	L207Q	probably damaging	Het
Tdrd6	T	C	17: 43,627,610	E849G	probably damaging	Het
Tedc2	T	C	17: 24,220,011	T111A	probably benign	Het
Tfg	T	A	16: 56,694,491		probably null	Het
Tgds	A	T	14: 118,116,231	S225T	probably benign	Het
Tnks2	T	A	19: 36,875,271	Y134*	probably null	Het
Trappc1	T	A	11: 69,325,530	V134D	probably damaging	Het
Ttc3	C	A	16: 94,442,761	P853Q	probably damaging	Het
Ttc7	C	A	17: 87,370,735		probably benign	Het
Ttf1	A	G	2: 29,074,594	S643G	probably damaging	Het
Tubgcp3	A	T	8: 12,650,171	S338T	probably damaging	Het
Ugt1a6a	T	C	1: 88,139,285	I271T	possibly damaging	Het
Vipas39	T	A	12: 87,241,301	Y445F	probably damaging	Het
Vmn1r31	A	C	6: 58,472,013	I289S	probably damaging	Het
Wdr92	T	C	11: 17,229,794	V265A	probably benign	Het
Zfp112	A	G	7: 24,126,260	E551G	probably damaging	Het
Zfp397	T	A	18: 23,960,797	Y446*	probably null	Het
Zfp442	A	T	2: 150,409,606	H124Q	probably damaging	Het

Other mutations in Itch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Itch	APN	2	155213023	missense	probably damaging	1.00
IGL00796:Itch	APN	2	155209082	missense	probably damaging	0.97
IGL01090:Itch	APN	2	155206336	missense	probably damaging	0.99
IGL01568:Itch	APN	2	155212462	splice site	probably benign
IGL01844:Itch	APN	2	155172547	missense	possibly damaging	0.56
IGL01844:Itch	APN	2	155172486	missense	possibly damaging	0.94
IGL01873:Itch	APN	2	155168750	missense	possibly damaging	0.68
IGL02129:Itch	APN	2	155217988	splice site	probably benign
IGL02386:Itch	APN	2	155202261	nonsense	probably null
IGL02545:Itch	APN	2	155172586	splice site	probably null
IGL02621:Itch	APN	2	155172584	splice site	probably null
IGL02708:Itch	APN	2	155174044	missense	probably benign	0.00
IGL02869:Itch	APN	2	155173933	critical splice acceptor site	probably null
Abrade	UTSW	2	155209078	missense	possibly damaging	0.93
dorsolateral	UTSW	2	155210558	nonsense	probably null
gadfly	UTSW	2	155182298	nonsense	probably null
hankerin	UTSW	2	155210582	critical splice donor site	probably null
prurient	UTSW	2	155210502	missense	probably damaging	1.00
scratch	UTSW	2	155172561	missense	probably damaging	0.99
R0116:Itch	UTSW	2	155217983	splice site	probably benign
R0207:Itch	UTSW	2	155202257	missense	probably benign
R0226:Itch	UTSW	2	155199394	missense	probably benign	0.01
R0545:Itch	UTSW	2	155182298	nonsense	probably null
R0689:Itch	UTSW	2	155182178	missense	possibly damaging	0.82
R1365:Itch	UTSW	2	155213031	missense	probably benign	0.00
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1436:Itch	UTSW	2	155192145	missense	probably damaging	0.96
R1639:Itch	UTSW	2	155179025	splice site	probably null
R1769:Itch	UTSW	2	155172561	missense	probably damaging	0.99
R1855:Itch	UTSW	2	155172454	splice site	probably benign
R1865:Itch	UTSW	2	155168746	missense	probably damaging	0.96
R2008:Itch	UTSW	2	155210459	missense	possibly damaging	0.91
R2054:Itch	UTSW	2	155210576	missense	probably damaging	1.00
R2196:Itch	UTSW	2	155202221	missense	probably benign
R2199:Itch	UTSW	2	155202221	missense	probably benign
R2252:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2253:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2348:Itch	UTSW	2	155209078	missense	possibly damaging	0.93
R2850:Itch	UTSW	2	155202221	missense	probably benign
R3021:Itch	UTSW	2	155209126	missense	possibly damaging	0.74
R4716:Itch	UTSW	2	155210582	critical splice donor site	probably null
R4888:Itch	UTSW	2	155217977	splice site	probably null
R4970:Itch	UTSW	2	155185593	missense	possibly damaging	0.50
R6029:Itch	UTSW	2	155179089	critical splice donor site	probably null
R6122:Itch	UTSW	2	155174065	missense	probably benign	0.05
R6435:Itch	UTSW	2	155209129	missense	probably benign	0.01
R6449:Itch	UTSW	2	155163395	splice site	probably benign
R7069:Itch	UTSW	2	155209994	missense	probably damaging	1.00
R7083:Itch	UTSW	2	155210444	missense	probably damaging	1.00
R7409:Itch	UTSW	2	155199382	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155210002	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155213067	missense	probably benign	0.00
R7974:Itch	UTSW	2	155192159	missense	probably damaging	1.00
R8046:Itch	UTSW	2	155210502	missense	probably damaging	1.00
R8248:Itch	UTSW	2	155206383	critical splice donor site	probably null
R8355:Itch	UTSW	2	155210582	critical splice donor site	probably null
R8428:Itch	UTSW	2	155168707	missense	probably benign	0.38
R8691:Itch	UTSW	2	155210558	nonsense	probably null
R8779:Itch	UTSW	2	155172520	missense	probably benign	0.28
Z1177:Itch	UTSW	2	155209059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATGATTGCGCTGGAG -3'
(R):5'- ATCATGCTGGGACAATGCTTTG -3'

Sequencing Primer
(F):5'- TGGAGTGGAAGCCCGATC -3'
(R):5'- CCCACCTCAAGTACAACTTT -3'

Posted On

2015-10-08