Incidental Mutation 'R4676:Mecom'
ID 349550
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene Name MDS1 and EVI1 complex locus
Synonyms Mds1, Jbo, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Evi1, ZNFPR1B1
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 30005445-30563937 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 30322817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172697] [ENSMUST00000172754] [ENSMUST00000173495] [ENSMUST00000173899]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091270
Predicted Effect probably benign
Transcript: ENSMUST00000172697
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173411
Predicted Effect probably benign
Transcript: ENSMUST00000173495
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192999
Predicted Effect probably benign
Transcript: ENSMUST00000173899
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 30,017,315 (GRCm39) missense probably damaging 0.99
IGL02800:Mecom APN 3 30,015,183 (GRCm39) missense probably damaging 1.00
IGL03052:Mecom APN 3 30,015,112 (GRCm39) splice site probably benign
IGL03237:Mecom APN 3 30,010,648 (GRCm39) intron probably benign
R0004:Mecom UTSW 3 30,034,060 (GRCm39) missense probably damaging 1.00
R0299:Mecom UTSW 3 30,034,560 (GRCm39) missense probably benign 0.41
R0324:Mecom UTSW 3 30,017,261 (GRCm39) missense probably damaging 0.99
R0485:Mecom UTSW 3 30,035,121 (GRCm39) intron probably benign
R0696:Mecom UTSW 3 30,010,538 (GRCm39) missense probably benign 0.01
R1322:Mecom UTSW 3 30,011,522 (GRCm39) missense probably damaging 0.98
R1396:Mecom UTSW 3 30,033,949 (GRCm39) missense possibly damaging 0.50
R1419:Mecom UTSW 3 30,035,038 (GRCm39) missense probably damaging 1.00
R1469:Mecom UTSW 3 30,034,197 (GRCm39) missense probably damaging 1.00
R1469:Mecom UTSW 3 30,034,197 (GRCm39) missense probably damaging 1.00
R1487:Mecom UTSW 3 30,034,213 (GRCm39) missense probably damaging 1.00
R1620:Mecom UTSW 3 30,041,237 (GRCm39) missense probably damaging 1.00
R1867:Mecom UTSW 3 30,563,577 (GRCm39) critical splice donor site probably null
R1876:Mecom UTSW 3 30,047,807 (GRCm39) missense probably damaging 1.00
R1922:Mecom UTSW 3 30,011,591 (GRCm39) missense probably damaging 0.99
R2044:Mecom UTSW 3 30,034,741 (GRCm39) missense probably damaging 1.00
R2087:Mecom UTSW 3 30,006,963 (GRCm39) missense probably benign 0.01
R2116:Mecom UTSW 3 30,019,607 (GRCm39) missense probably damaging 1.00
R3500:Mecom UTSW 3 30,035,061 (GRCm39) missense probably damaging 1.00
R4348:Mecom UTSW 3 30,020,887 (GRCm39) missense possibly damaging 0.72
R4350:Mecom UTSW 3 30,020,887 (GRCm39) missense possibly damaging 0.72
R4351:Mecom UTSW 3 30,020,887 (GRCm39) missense possibly damaging 0.72
R4352:Mecom UTSW 3 30,020,887 (GRCm39) missense possibly damaging 0.72
R4353:Mecom UTSW 3 30,020,887 (GRCm39) missense possibly damaging 0.72
R4358:Mecom UTSW 3 30,033,934 (GRCm39) nonsense probably null
R4370:Mecom UTSW 3 30,011,504 (GRCm39) missense probably damaging 1.00
R4380:Mecom UTSW 3 30,041,219 (GRCm39) missense probably damaging 1.00
R4690:Mecom UTSW 3 30,292,459 (GRCm39) missense probably benign 0.01
R4750:Mecom UTSW 3 30,011,679 (GRCm39) missense probably damaging 0.97
R4812:Mecom UTSW 3 30,194,517 (GRCm39) start codon destroyed probably null
R4821:Mecom UTSW 3 30,039,500 (GRCm39) missense probably damaging 1.00
R4986:Mecom UTSW 3 30,034,848 (GRCm39) missense probably damaging 0.99
R5020:Mecom UTSW 3 30,015,255 (GRCm39) missense probably damaging 1.00
R5099:Mecom UTSW 3 30,039,465 (GRCm39) intron probably benign
R5410:Mecom UTSW 3 30,051,870 (GRCm39) missense probably benign 0.01
R5415:Mecom UTSW 3 30,011,675 (GRCm39) missense possibly damaging 0.93
R5556:Mecom UTSW 3 30,292,249 (GRCm39) missense probably damaging 1.00
R5811:Mecom UTSW 3 30,015,149 (GRCm39) missense probably benign 0.00
R5955:Mecom UTSW 3 30,015,195 (GRCm39) missense probably damaging 1.00
R6153:Mecom UTSW 3 30,047,797 (GRCm39) missense possibly damaging 0.92
R6321:Mecom UTSW 3 30,034,741 (GRCm39) missense probably damaging 1.00
R6335:Mecom UTSW 3 30,034,905 (GRCm39) missense probably damaging 1.00
R6383:Mecom UTSW 3 30,051,875 (GRCm39) missense probably damaging 1.00
R6435:Mecom UTSW 3 30,034,398 (GRCm39) missense probably damaging 1.00
R6468:Mecom UTSW 3 30,194,535 (GRCm39) intron probably benign
R6476:Mecom UTSW 3 30,034,717 (GRCm39) missense possibly damaging 0.70
R6673:Mecom UTSW 3 30,034,851 (GRCm39) missense probably benign 0.09
R6721:Mecom UTSW 3 30,034,023 (GRCm39) missense probably damaging 1.00
R7071:Mecom UTSW 3 30,034,857 (GRCm39) missense probably damaging 1.00
R7095:Mecom UTSW 3 30,035,103 (GRCm39) missense probably damaging 1.00
R7131:Mecom UTSW 3 30,035,094 (GRCm39) missense probably damaging 1.00
R7247:Mecom UTSW 3 30,194,505 (GRCm39) missense unknown
R7265:Mecom UTSW 3 30,034,282 (GRCm39) missense possibly damaging 0.65
R7556:Mecom UTSW 3 30,041,220 (GRCm39) missense probably benign 0.01
R7599:Mecom UTSW 3 30,010,534 (GRCm39) missense probably damaging 0.96
R7609:Mecom UTSW 3 30,010,591 (GRCm39) missense probably damaging 0.99
R7844:Mecom UTSW 3 30,063,973 (GRCm39) missense unknown
R8047:Mecom UTSW 3 30,292,404 (GRCm39) missense
R8070:Mecom UTSW 3 30,033,987 (GRCm39) missense probably damaging 1.00
R8316:Mecom UTSW 3 30,011,529 (GRCm39) missense probably benign 0.01
R8351:Mecom UTSW 3 30,039,519 (GRCm39) missense probably benign 0.00
R8451:Mecom UTSW 3 30,039,519 (GRCm39) missense probably benign 0.00
R8757:Mecom UTSW 3 30,292,268 (GRCm39) missense
R8890:Mecom UTSW 3 30,006,882 (GRCm39) missense probably damaging 1.00
R8982:Mecom UTSW 3 30,017,255 (GRCm39) missense probably damaging 1.00
R9003:Mecom UTSW 3 30,034,639 (GRCm39) missense probably benign 0.00
R9328:Mecom UTSW 3 30,063,994 (GRCm39) missense unknown
R9425:Mecom UTSW 3 30,039,597 (GRCm39) missense probably benign 0.00
R9508:Mecom UTSW 3 30,010,621 (GRCm39) missense probably benign 0.01
R9681:Mecom UTSW 3 30,033,803 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTTTGCAGGACTCAGAGACAAC -3'
(R):5'- TTTTACCAAAGGCATGTCCCAG -3'

Sequencing Primer
(F):5'- TGCAGGACTCAGAGACAACTTTGTAC -3'
(R):5'- TAGACACAGGGGCCTCATCTTC -3'
Posted On 2015-10-08