Mutagenetix > Incidental Mutation

Incidental Mutation 'R4676:Rxfp1'

349552

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

042013-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R4676 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79705668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 32 (F32L)

Ref Sequence

ENSEMBL: ENSMUSP00000138578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

AlphaFold

Q6R6I7

Predicted Effect

probably damaging
Transcript: ENSMUST00000078527
AA Change: F32L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: F32L

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182491
AA Change: F32L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009
AA Change: F32L

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Meta Mutation Damage Score

0.8680

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	T	A	1: 120,150,652	I13N	probably damaging	Het
Abcd3	T	A	3: 121,774,166	T409S	possibly damaging	Het
Acad12	C	A	5: 121,607,171	W317L	probably damaging	Het
Acap1	T	A	11: 69,889,468	M50L	probably benign	Het
Acvr1b	T	A	15: 101,202,986	V343E	probably damaging	Het
Adgb	C	A	10: 10,426,710	G371W	probably damaging	Het
AF529169	A	G	9: 89,601,553	V597A	probably damaging	Het
Akap9	A	G	5: 4,032,774	K1966R	probably damaging	Het
Akap9	C	T	5: 4,064,515	Q48*	probably null	Het
Ano10	T	C	9: 122,263,787	R159G	probably damaging	Het
Anxa7	T	C	14: 20,467,915	M128V	probably benign	Het
Arhgef40	C	A	14: 51,990,959	C554*	probably null	Het
Asna1	C	T	8: 85,018,873	A219T	probably benign	Het
Atf6	T	C	1: 170,787,410	Y538C	probably damaging	Het
Atp8b1	A	C	18: 64,538,678	D1091E	probably benign	Het
BC034090	A	G	1: 155,226,264	Y85H	possibly damaging	Het
BC067074	C	A	13: 113,368,807	L2157I	probably damaging	Het
BC067074	T	G	13: 113,368,808	L2157R	probably damaging	Het
Bcas2	A	G	3: 103,175,701		probably benign	Het
Bnc2	T	C	4: 84,292,819	N463D	probably damaging	Het
Capn7	A	T	14: 31,359,259	H411L	possibly damaging	Het
Cavin3	T	C	7: 105,481,113	E164G	probably damaging	Het
Ccdc191	T	C	16: 43,939,173		probably benign	Het
Ccdc88b	A	G	19: 6,853,000	V858A	probably benign	Het
Clcn3	A	G	8: 60,930,651		probably benign	Het
Commd6	T	C	14: 101,640,284		probably benign	Het
Cul3	G	A	1: 80,271,674	L561F	probably damaging	Het
Cyfip1	T	A	7: 55,875,013	I131N	probably damaging	Het
Dlgap3	T	A	4: 127,233,761	Y741N	probably damaging	Het
Dnah5	A	T	15: 28,295,260	I1380F	possibly damaging	Het
Dync1h1	G	T	12: 110,662,541	L4177F	probably damaging	Het
Ethe1	G	A	7: 24,607,894	V178M	probably damaging	Het
Flnc	A	T	6: 29,445,154		probably null	Het
Glt8d1	T	C	14: 31,006,692	F26L	probably benign	Het
Gm5493	T	A	17: 22,748,081	D63E	probably benign	Het
Gm9996	T	A	10: 29,143,838		probably benign	Het
Gnl2	T	G	4: 125,053,473	S629R	possibly damaging	Het
Gpbp1l1	T	C	4: 116,590,265	S381P	probably damaging	Het
Igsf10	A	C	3: 59,325,949	F1788V	probably benign	Het
Inpp5d	C	A	1: 87,715,142	P935Q	probably damaging	Het
Itch	A	C	2: 155,199,435	I468L	probably benign	Het
Itga5	A	T	15: 103,357,210	Y192N	probably damaging	Het
Itih3	T	A	14: 30,918,949	Q302L	probably null	Het
Itih3	T	A	14: 30,921,686	Q121L	possibly damaging	Het
Kctd17	T	A	15: 78,435,759		probably benign	Het
Lsm1	T	C	8: 25,793,689	L43P	probably damaging	Het
Magi3	A	T	3: 104,015,825	M1192K	probably benign	Het
Mecom	A	G	3: 30,268,668		probably benign	Het
Mtmr3	A	T	11: 4,527,855	F63Y	probably benign	Het
Naa16	A	G	14: 79,336,348		probably benign	Het
Neto1	A	T	18: 86,398,302	T45S	possibly damaging	Het
Nlrp4a	A	T	7: 26,450,229	R420S	probably damaging	Het
Nr1h4	T	C	10: 89,473,874	D317G	probably damaging	Het
Olfr1497	T	A	19: 13,795,474	I46F	possibly damaging	Het
Olfr1504	C	T	19: 13,887,401	D270N	probably damaging	Het
Olfr920	A	G	9: 38,755,659		probably benign	Het
Pde5a	A	T	3: 122,747,893	M11L	possibly damaging	Het
Plxnb1	G	A	9: 109,110,435	R1416Q	possibly damaging	Het
Polm	A	T	11: 5,835,749	Y141*	probably null	Het
Scrt1	T	A	15: 76,521,668	D13V	possibly damaging	Het
Slc1a7	T	A	4: 107,977,674	V79E	possibly damaging	Het
Snurf	T	C	7: 59,995,522	Q48R	probably benign	Het
Srek1	T	C	13: 103,758,187		probably benign	Het
Stxbp5l	T	C	16: 37,255,884	S267G	probably damaging	Het
Taf5	C	T	19: 47,074,970	R320W	probably damaging	Het
Tars2	A	T	3: 95,753,091	N106K	probably damaging	Het
Tatdn3	A	T	1: 191,049,334	L207Q	probably damaging	Het
Tdrd6	T	C	17: 43,627,610	E849G	probably damaging	Het
Tedc2	T	C	17: 24,220,011	T111A	probably benign	Het
Tfg	T	A	16: 56,694,491		probably null	Het
Tgds	A	T	14: 118,116,231	S225T	probably benign	Het
Tnks2	T	A	19: 36,875,271	Y134*	probably null	Het
Trappc1	T	A	11: 69,325,530	V134D	probably damaging	Het
Ttc3	C	A	16: 94,442,761	P853Q	probably damaging	Het
Ttc7	C	A	17: 87,370,735		probably benign	Het
Ttf1	A	G	2: 29,074,594	S643G	probably damaging	Het
Tubgcp3	A	T	8: 12,650,171	S338T	probably damaging	Het
Ugt1a6a	T	C	1: 88,139,285	I271T	possibly damaging	Het
Vipas39	T	A	12: 87,241,301	Y445F	probably damaging	Het
Vmn1r31	A	C	6: 58,472,013	I289S	probably damaging	Het
Wdr92	T	C	11: 17,229,794	V265A	probably benign	Het
Zfp112	A	G	7: 24,126,260	E551G	probably damaging	Het
Zfp397	T	A	18: 23,960,797	Y446*	probably null	Het
Zfp442	A	T	2: 150,409,606	H124Q	probably damaging	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
R8723:Rxfp1	UTSW	3	79650495	missense	probably benign
R8786:Rxfp1	UTSW	3	79663370	critical splice acceptor site	probably null
R8887:Rxfp1	UTSW	3	79651982	intron	probably benign
R8939:Rxfp1	UTSW	3	79644924	missense	probably damaging	0.99
R9245:Rxfp1	UTSW	3	79644954	missense	probably benign	0.12
R9574:Rxfp1	UTSW	3	79656274	missense	probably benign	0.01
R9579:Rxfp1	UTSW	3	79650639	missense	probably damaging	1.00
R9799:Rxfp1	UTSW	3	79670875	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAGGCAAATCAGCTGTGTG -3'
(R):5'- GGCACTGGAAAGCAGCTATG -3'

Sequencing Primer
(F):5'- GCAAATCAGCTGTGTGCCAAC -3'
(R):5'- AAAGCAGCTATGGGCCCTG -3'

Posted On

2015-10-08