Incidental Mutation 'R4676:Tars2'
ID 349553
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Name threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms Tarsl1, 2610024N01Rik
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 95647286-95663677 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95660403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 106 (N106K)
Ref Sequence ENSEMBL: ENSMUSP00000143328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000199464] [ENSMUST00000199570] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000197501]
AlphaFold Q3UQ84
Predicted Effect probably damaging
Transcript: ENSMUST00000029752
AA Change: N106K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074339
AA Change: N106K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098857
AA Change: N106K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163530
AA Change: N106K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195929
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196077
AA Change: N105K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107
AA Change: N105K

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196475
Predicted Effect probably benign
Transcript: ENSMUST00000196868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198007
Predicted Effect probably damaging
Transcript: ENSMUST00000199464
AA Change: N106K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199570
AA Change: N106K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107
AA Change: N106K

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.5e-13 PFAM
tRNA_SAD 152 201 8.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect probably benign
Transcript: ENSMUST00000197720
Predicted Effect probably benign
Transcript: ENSMUST00000198289
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197501
Meta Mutation Damage Score 0.8574 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95,647,590 (GRCm39) missense probably damaging 1.00
IGL02523:Tars2 APN 3 95,648,705 (GRCm39) missense probably damaging 1.00
IGL02709:Tars2 APN 3 95,649,383 (GRCm39) splice site probably benign
IGL03286:Tars2 APN 3 95,662,067 (GRCm39) splice site probably benign
IGL03348:Tars2 APN 3 95,647,580 (GRCm39) splice site probably null
B6584:Tars2 UTSW 3 95,649,462 (GRCm39) splice site probably null
R0548:Tars2 UTSW 3 95,649,971 (GRCm39) missense probably damaging 1.00
R0657:Tars2 UTSW 3 95,655,869 (GRCm39) missense probably benign 0.00
R1955:Tars2 UTSW 3 95,654,766 (GRCm39) missense probably damaging 1.00
R2070:Tars2 UTSW 3 95,654,950 (GRCm39) missense probably damaging 1.00
R2071:Tars2 UTSW 3 95,654,950 (GRCm39) missense probably damaging 1.00
R3025:Tars2 UTSW 3 95,654,952 (GRCm39) missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95,662,068 (GRCm39) critical splice donor site probably null
R4775:Tars2 UTSW 3 95,653,959 (GRCm39) missense probably damaging 1.00
R5208:Tars2 UTSW 3 95,654,905 (GRCm39) missense probably damaging 1.00
R5512:Tars2 UTSW 3 95,657,728 (GRCm39) missense probably damaging 1.00
R5894:Tars2 UTSW 3 95,654,964 (GRCm39) splice site probably null
R5965:Tars2 UTSW 3 95,655,464 (GRCm39) splice site probably null
R6381:Tars2 UTSW 3 95,661,799 (GRCm39) nonsense probably null
R6953:Tars2 UTSW 3 95,660,426 (GRCm39) missense possibly damaging 0.63
R7042:Tars2 UTSW 3 95,658,057 (GRCm39) missense probably benign 0.00
R7648:Tars2 UTSW 3 95,658,294 (GRCm39) missense probably benign 0.26
R7877:Tars2 UTSW 3 95,653,401 (GRCm39) missense probably damaging 0.99
R7946:Tars2 UTSW 3 95,657,693 (GRCm39) missense probably damaging 0.99
R8021:Tars2 UTSW 3 95,654,826 (GRCm39) missense probably benign
R8260:Tars2 UTSW 3 95,662,132 (GRCm39) missense probably damaging 0.99
R8310:Tars2 UTSW 3 95,658,271 (GRCm39) missense probably benign 0.02
R8681:Tars2 UTSW 3 95,658,199 (GRCm39) nonsense probably null
R8697:Tars2 UTSW 3 95,653,374 (GRCm39) missense possibly damaging 0.75
R8756:Tars2 UTSW 3 95,648,672 (GRCm39) missense probably benign 0.32
R9498:Tars2 UTSW 3 95,647,553 (GRCm39) missense probably damaging 1.00
R9653:Tars2 UTSW 3 95,655,379 (GRCm39) missense probably damaging 1.00
R9746:Tars2 UTSW 3 95,662,077 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GGTTCCACAGGAATAATTAGTCTGTG -3'
(R):5'- TGCCCTTCCCAATGTAGTGG -3'

Sequencing Primer
(F):5'- CCTCCCCACTTTTGAATTGAGAAAG -3'
(R):5'- TGGATACATTGGGAAAAGAAACAGC -3'
Posted On 2015-10-08