Incidental Mutation 'R4676:Pde5a'
ID 349557
Institutional Source Beutler Lab
Gene Symbol Pde5a
Ensembl Gene ENSMUSG00000053965
Gene Name phosphodiesterase 5A, cGMP-specific
Synonyms PDE5A1, Pde5
MMRRC Submission 042013-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 122728947-122859374 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122747893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 11 (M11L)
Ref Sequence ENSEMBL: ENSMUSP00000143042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]
AlphaFold Q8CG03
Predicted Effect probably benign
Transcript: ENSMUST00000066728
AA Change: M43L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: M43L

DomainStartEndE-ValueType
Blast:GAF 64 152 4e-42 BLAST
GAF 154 314 2.23e-31 SMART
GAF 336 503 9.8e-28 SMART
HDc 600 768 8.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198314
Predicted Effect possibly damaging
Transcript: ENSMUST00000200389
AA Change: M11L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965
AA Change: M11L

DomainStartEndE-ValueType
Blast:GAF 32 120 3e-42 BLAST
GAF 122 282 1.1e-33 SMART
GAF 304 471 4.7e-30 SMART
HDc 568 736 4.4e-11 SMART
Meta Mutation Damage Score 0.1684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Pde5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pde5a APN 3 122794357 missense probably damaging 1.00
IGL00945:Pde5a APN 3 122835642 critical splice donor site probably null
IGL01395:Pde5a APN 3 122817955 missense probably benign 0.40
IGL01872:Pde5a APN 3 122794369 critical splice donor site probably null
IGL01947:Pde5a APN 3 122835610 missense probably damaging 1.00
IGL02033:Pde5a APN 3 122803061 missense possibly damaging 0.51
IGL02209:Pde5a APN 3 122825015 splice site probably benign
IGL02220:Pde5a APN 3 122748382 missense probably benign 0.05
IGL02301:Pde5a APN 3 122760885 missense probably damaging 1.00
IGL02748:Pde5a APN 3 122760892 missense probably damaging 0.99
R0009:Pde5a UTSW 3 122824902 splice site probably benign
R0031:Pde5a UTSW 3 122803055 missense probably benign 0.00
R0119:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0390:Pde5a UTSW 3 122835583 missense probably damaging 1.00
R0481:Pde5a UTSW 3 122818077 splice site probably benign
R0499:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0657:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0845:Pde5a UTSW 3 122729331 missense probably benign 0.28
R0908:Pde5a UTSW 3 122779001 missense probably benign 0.01
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1553:Pde5a UTSW 3 122778936 missense probably benign 0.14
R1728:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R1744:Pde5a UTSW 3 122747897 missense probably damaging 0.97
R1774:Pde5a UTSW 3 122729364 missense probably benign 0.01
R1784:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R2437:Pde5a UTSW 3 122843053 missense probably damaging 1.00
R2844:Pde5a UTSW 3 122851708 missense probably damaging 1.00
R2897:Pde5a UTSW 3 122779002 missense probably benign 0.03
R2936:Pde5a UTSW 3 122794319 missense probably damaging 0.97
R3160:Pde5a UTSW 3 122781628 nonsense probably null
R3162:Pde5a UTSW 3 122781628 nonsense probably null
R3704:Pde5a UTSW 3 122779019 missense probably benign 0.00
R3847:Pde5a UTSW 3 122803160 missense probably damaging 0.98
R3932:Pde5a UTSW 3 122760896 missense probably damaging 0.98
R4387:Pde5a UTSW 3 122729352 missense probably benign 0.00
R4613:Pde5a UTSW 3 122823093 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852586 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852587 missense probably damaging 1.00
R5358:Pde5a UTSW 3 122748176 missense probably damaging 1.00
R5394:Pde5a UTSW 3 122818009 missense probably damaging 1.00
R5502:Pde5a UTSW 3 122803032 missense probably damaging 1.00
R5821:Pde5a UTSW 3 122817955 missense probably benign 0.40
R5932:Pde5a UTSW 3 122841044 missense probably benign 0.01
R6063:Pde5a UTSW 3 122824925 missense probably benign 0.23
R6190:Pde5a UTSW 3 122729307 missense probably benign 0.28
R6815:Pde5a UTSW 3 122824924 missense probably benign 0.01
R6940:Pde5a UTSW 3 122779032 missense possibly damaging 0.53
R7274:Pde5a UTSW 3 122855246 nonsense probably null
R7337:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R7384:Pde5a UTSW 3 122825000 missense probably damaging 1.00
R7480:Pde5a UTSW 3 122803148 missense possibly damaging 0.50
R7508:Pde5a UTSW 3 122818030 missense probably damaging 1.00
R7522:Pde5a UTSW 3 122840999 nonsense probably null
R7623:Pde5a UTSW 3 122774601 missense probably benign
R8153:Pde5a UTSW 3 122852576 missense probably benign 0.30
R8153:Pde5a UTSW 3 122852578 missense probably damaging 1.00
R8351:Pde5a UTSW 3 122748479 critical splice donor site probably null
R8927:Pde5a UTSW 3 122839600 missense probably damaging 1.00
R8928:Pde5a UTSW 3 122839600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGCCATCCATAGAGATCTCC -3'
(R):5'- GAAAGCTCACTGTTCCCTCG -3'

Sequencing Primer
(F):5'- GCCATCCATAGAGATCTCCATGTGTG -3'
(R):5'- CTCGGAATCCTTGACAACAATGGG -3'
Posted On 2015-10-08