Mutagenetix > Incidental Mutations

Incidental Mutation 'R4676:Flnc'

349567

Institutional Source

Beutler Lab

Gene Symbol

Flnc

Ensembl Gene

ENSMUSG00000068699

Gene Name

filamin C, gamma

Synonyms

1110055E19Rik, actin binding protein 280, Fln2

MMRRC Submission

042013-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4676 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29433256-29461883 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to T at 29445154 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099139 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]

Predicted Effect

probably null
Transcript: ENSMUST00000065090

SMART Domains

Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	1.05e-30	SMART
IG_FLMN	1777	1858	2.93e-11	SMART
IG_FLMN	1859	1950	2.55e-43	SMART
IG_FLMN	1951	2037	2.43e-17	SMART
IG_FLMN	2041	2132	1.52e-41	SMART
PDB:2E9I\|A	2133	2162	3e-7	PDB
IG_FLMN	2217	2310	2.93e-11	SMART
IG_FLMN	2314	2405	1.67e-38	SMART
IG_FLMN	2408	2500	2.56e-25	SMART
IG_FLMN	2505	2596	9.54e-34	SMART
low complexity region	2618	2628	N/A	INTRINSIC
IG_FLMN	2635	2737	2.11e-26	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000101617

SMART Domains

Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	6.11e-32	SMART
IG_FLMN	1744	1825	2.93e-11	SMART
IG_FLMN	1826	1917	2.55e-43	SMART
IG_FLMN	1918	2004	2.43e-17	SMART
IG_FLMN	2008	2099	1.52e-41	SMART
PDB:2E9I\|A	2100	2129	3e-7	PDB
IG_FLMN	2184	2277	2.93e-11	SMART
IG_FLMN	2281	2372	1.67e-38	SMART
IG_FLMN	2375	2467	2.56e-25	SMART
IG_FLMN	2472	2563	9.54e-34	SMART
low complexity region	2585	2595	N/A	INTRINSIC
IG_FLMN	2602	2704	2.11e-26	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	T	A	1: 120,150,652	I13N	probably damaging	Het
Abcd3	T	A	3: 121,774,166	T409S	possibly damaging	Het
Acad12	C	A	5: 121,607,171	W317L	probably damaging	Het
Acap1	T	A	11: 69,889,468	M50L	probably benign	Het
Acvr1b	T	A	15: 101,202,986	V343E	probably damaging	Het
Adgb	C	A	10: 10,426,710	G371W	probably damaging	Het
AF529169	A	G	9: 89,601,553	V597A	probably damaging	Het
Akap9	A	G	5: 4,032,774	K1966R	probably damaging	Het
Akap9	C	T	5: 4,064,515	Q48*	probably null	Het
Ano10	T	C	9: 122,263,787	R159G	probably damaging	Het
Anxa7	T	C	14: 20,467,915	M128V	probably benign	Het
Arhgef40	C	A	14: 51,990,959	C554*	probably null	Het
Asna1	C	T	8: 85,018,873	A219T	probably benign	Het
Atf6	T	C	1: 170,787,410	Y538C	probably damaging	Het
Atp8b1	A	C	18: 64,538,678	D1091E	probably benign	Het
BC034090	A	G	1: 155,226,264	Y85H	possibly damaging	Het
BC067074	C	A	13: 113,368,807	L2157I	probably damaging	Het
BC067074	T	G	13: 113,368,808	L2157R	probably damaging	Het
Bcas2	A	G	3: 103,175,701		probably benign	Het
Bnc2	T	C	4: 84,292,819	N463D	probably damaging	Het
Capn7	A	T	14: 31,359,259	H411L	possibly damaging	Het
Cavin3	T	C	7: 105,481,113	E164G	probably damaging	Het
Ccdc191	T	C	16: 43,939,173		probably benign	Het
Ccdc88b	A	G	19: 6,853,000	V858A	probably benign	Het
Clcn3	A	G	8: 60,930,651		probably benign	Het
Commd6	T	C	14: 101,640,284		probably benign	Het
Cul3	G	A	1: 80,271,674	L561F	probably damaging	Het
Cyfip1	T	A	7: 55,875,013	I131N	probably damaging	Het
Dlgap3	T	A	4: 127,233,761	Y741N	probably damaging	Het
Dnah5	A	T	15: 28,295,260	I1380F	possibly damaging	Het
Dync1h1	G	T	12: 110,662,541	L4177F	probably damaging	Het
Ethe1	G	A	7: 24,607,894	V178M	probably damaging	Het
Glt8d1	T	C	14: 31,006,692	F26L	probably benign	Het
Gm5493	T	A	17: 22,748,081	D63E	probably benign	Het
Gm9996	T	A	10: 29,143,838		probably benign	Het
Gnl2	T	G	4: 125,053,473	S629R	possibly damaging	Het
Gpbp1l1	T	C	4: 116,590,265	S381P	probably damaging	Het
Igsf10	A	C	3: 59,325,949	F1788V	probably benign	Het
Inpp5d	C	A	1: 87,715,142	P935Q	probably damaging	Het
Itch	A	C	2: 155,199,435	I468L	probably benign	Het
Itga5	A	T	15: 103,357,210	Y192N	probably damaging	Het
Itih3	T	A	14: 30,921,686	Q121L	possibly damaging	Het
Itih3	T	A	14: 30,918,949	Q302L	probably null	Het
Kctd17	T	A	15: 78,435,759		probably benign	Het
Lsm1	T	C	8: 25,793,689	L43P	probably damaging	Het
Magi3	A	T	3: 104,015,825	M1192K	probably benign	Het
Mecom	A	G	3: 30,268,668		probably benign	Het
Mtmr3	A	T	11: 4,527,855	F63Y	probably benign	Het
Naa16	A	G	14: 79,336,348		probably benign	Het
Neto1	A	T	18: 86,398,302	T45S	possibly damaging	Het
Nlrp4a	A	T	7: 26,450,229	R420S	probably damaging	Het
Nr1h4	T	C	10: 89,473,874	D317G	probably damaging	Het
Olfr1497	T	A	19: 13,795,474	I46F	possibly damaging	Het
Olfr1504	C	T	19: 13,887,401	D270N	probably damaging	Het
Olfr920	A	G	9: 38,755,659		probably benign	Het
Pde5a	A	T	3: 122,747,893	M11L	possibly damaging	Het
Plxnb1	G	A	9: 109,110,435	R1416Q	possibly damaging	Het
Polm	A	T	11: 5,835,749	Y141*	probably null	Het
Rxfp1	A	G	3: 79,705,668	F32L	probably damaging	Het
Scrt1	T	A	15: 76,521,668	D13V	possibly damaging	Het
Slc1a7	T	A	4: 107,977,674	V79E	possibly damaging	Het
Snurf	T	C	7: 59,995,522	Q48R	probably benign	Het
Srek1	T	C	13: 103,758,187		probably benign	Het
Stxbp5l	T	C	16: 37,255,884	S267G	probably damaging	Het
Taf5	C	T	19: 47,074,970	R320W	probably damaging	Het
Tars2	A	T	3: 95,753,091	N106K	probably damaging	Het
Tatdn3	A	T	1: 191,049,334	L207Q	probably damaging	Het
Tdrd6	T	C	17: 43,627,610	E849G	probably damaging	Het
Tedc2	T	C	17: 24,220,011	T111A	probably benign	Het
Tfg	T	A	16: 56,694,491		probably null	Het
Tgds	A	T	14: 118,116,231	S225T	probably benign	Het
Tnks2	T	A	19: 36,875,271	Y134*	probably null	Het
Trappc1	T	A	11: 69,325,530	V134D	probably damaging	Het
Ttc3	C	A	16: 94,442,761	P853Q	probably damaging	Het
Ttc7	C	A	17: 87,370,735		probably benign	Het
Ttf1	A	G	2: 29,074,594	S643G	probably damaging	Het
Tubgcp3	A	T	8: 12,650,171	S338T	probably damaging	Het
Ugt1a6a	T	C	1: 88,139,285	I271T	possibly damaging	Het
Vipas39	T	A	12: 87,241,301	Y445F	probably damaging	Het
Vmn1r31	A	C	6: 58,472,013	I289S	probably damaging	Het
Wdr92	T	C	11: 17,229,794	V265A	probably benign	Het
Zfp112	A	G	7: 24,126,260	E551G	probably damaging	Het
Zfp397	T	A	18: 23,960,797	Y446*	probably null	Het
Zfp442	A	T	2: 150,409,606	H124Q	probably damaging	Het

Other mutations in Flnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Flnc	APN	6	29459547	nonsense	probably null
IGL01099:Flnc	APN	6	29433618	missense	probably damaging	0.99
IGL01656:Flnc	APN	6	29443508	splice site	probably benign
IGL01659:Flnc	APN	6	29448671	missense	probably damaging	0.98
IGL01780:Flnc	APN	6	29438493	nonsense	probably null
IGL01935:Flnc	APN	6	29454280	missense	probably damaging	1.00
IGL02039:Flnc	APN	6	29450719	missense	probably benign	0.05
IGL02119:Flnc	APN	6	29447512	missense	probably damaging	0.98
IGL02122:Flnc	APN	6	29444336	missense	possibly damaging	0.70
IGL02236:Flnc	APN	6	29454376	missense	probably damaging	1.00
IGL02350:Flnc	APN	6	29438493	nonsense	probably null
IGL02357:Flnc	APN	6	29438493	nonsense	probably null
IGL02428:Flnc	APN	6	29451485	missense	probably damaging	1.00
IGL02496:Flnc	APN	6	29440685	missense	probably damaging	0.98
IGL02516:Flnc	APN	6	29450841	missense	probably damaging	0.99
IGL02696:Flnc	APN	6	29446698	missense	probably damaging	0.98
IGL03165:Flnc	APN	6	29449378	missense	probably damaging	1.00
IGL03190:Flnc	APN	6	29445637	splice site	probably benign
I1329:Flnc	UTSW	6	29451415	missense	probably damaging	1.00
R0111:Flnc	UTSW	6	29454340	missense	probably damaging	0.99
R0665:Flnc	UTSW	6	29455531	missense	probably damaging	1.00
R0748:Flnc	UTSW	6	29446344	missense	probably damaging	0.99
R0960:Flnc	UTSW	6	29441512	missense	probably damaging	1.00
R1328:Flnc	UTSW	6	29438613	missense	probably damaging	1.00
R1502:Flnc	UTSW	6	29438694	missense	probably benign	0.45
R1544:Flnc	UTSW	6	29444080	missense	probably benign	0.00
R1565:Flnc	UTSW	6	29455171	missense	probably damaging	1.00
R1640:Flnc	UTSW	6	29433807	missense	possibly damaging	0.78
R1691:Flnc	UTSW	6	29441214	missense	probably benign	0.09
R1818:Flnc	UTSW	6	29457448	missense	probably damaging	1.00
R1826:Flnc	UTSW	6	29455185	missense	probably damaging	0.99
R1851:Flnc	UTSW	6	29443479	missense	probably damaging	1.00
R1898:Flnc	UTSW	6	29438666	nonsense	probably null
R1905:Flnc	UTSW	6	29459460	missense	probably damaging	1.00
R1985:Flnc	UTSW	6	29444416	splice site	probably benign
R2016:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2017:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2020:Flnc	UTSW	6	29444363	missense	probably damaging	0.97
R2104:Flnc	UTSW	6	29450735	critical splice donor site	probably null
R2132:Flnc	UTSW	6	29443676	missense	probably damaging	1.00
R2141:Flnc	UTSW	6	29448675	missense	probably damaging	1.00
R2197:Flnc	UTSW	6	29459135	missense	probably damaging	1.00
R2202:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2203:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2204:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2205:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2209:Flnc	UTSW	6	29455845	missense	possibly damaging	0.91
R2248:Flnc	UTSW	6	29451401	missense	probably damaging	0.99
R2258:Flnc	UTSW	6	29438666	nonsense	probably null
R2259:Flnc	UTSW	6	29438666	nonsense	probably null
R2280:Flnc	UTSW	6	29438666	nonsense	probably null
R2281:Flnc	UTSW	6	29438666	nonsense	probably null
R2873:Flnc	UTSW	6	29447543	missense	probably damaging	0.96
R2900:Flnc	UTSW	6	29448585	missense	probably damaging	0.98
R3788:Flnc	UTSW	6	29454057	missense	probably damaging	0.99
R3799:Flnc	UTSW	6	29443739	missense	probably damaging	1.00
R3801:Flnc	UTSW	6	29447404	missense	probably damaging	0.98
R3851:Flnc	UTSW	6	29453719	missense	probably damaging	1.00
R3910:Flnc	UTSW	6	29459427	missense	probably damaging	1.00
R3982:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R3983:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R4023:Flnc	UTSW	6	29451635	missense	possibly damaging	0.95
R4694:Flnc	UTSW	6	29443448	missense	probably damaging	1.00
R4695:Flnc	UTSW	6	29440429	missense	probably damaging	0.99
R4735:Flnc	UTSW	6	29455813	missense	probably damaging	1.00
R4773:Flnc	UTSW	6	29445039	missense	possibly damaging	0.96
R4828:Flnc	UTSW	6	29455167	missense	probably damaging	1.00
R4856:Flnc	UTSW	6	29447890	missense	probably damaging	1.00
R4879:Flnc	UTSW	6	29460806	missense	probably damaging	0.99
R4899:Flnc	UTSW	6	29446843	missense	probably benign	0.17
R4906:Flnc	UTSW	6	29447525	missense	probably damaging	0.99
R5089:Flnc	UTSW	6	29447813	missense	probably damaging	0.96
R5173:Flnc	UTSW	6	29455538	missense	probably damaging	1.00
R5174:Flnc	UTSW	6	29448894	missense	possibly damaging	0.91
R5290:Flnc	UTSW	6	29457554	missense	probably damaging	1.00
R5338:Flnc	UTSW	6	29444064	missense	possibly damaging	0.47
R5352:Flnc	UTSW	6	29449318	missense	possibly damaging	0.85
R5397:Flnc	UTSW	6	29441161	missense	possibly damaging	0.87
R5431:Flnc	UTSW	6	29456384	missense	possibly damaging	0.74
R5481:Flnc	UTSW	6	29441217	missense	probably damaging	1.00
R5511:Flnc	UTSW	6	29458898	missense	probably damaging	1.00
R5539:Flnc	UTSW	6	29446230	missense	probably damaging	1.00
R5549:Flnc	UTSW	6	29453691	missense	probably damaging	1.00
R5567:Flnc	UTSW	6	29444045	nonsense	probably null
R5584:Flnc	UTSW	6	29446628	missense	probably damaging	0.98
R5689:Flnc	UTSW	6	29441592	missense	probably benign	0.03
R5753:Flnc	UTSW	6	29433489	missense	probably benign
R5786:Flnc	UTSW	6	29459537	nonsense	probably null
R5822:Flnc	UTSW	6	29459430	missense	probably damaging	0.98
R5823:Flnc	UTSW	6	29461202	missense	probably damaging	0.99
R5933:Flnc	UTSW	6	29441106	missense	probably damaging	0.99
R6043:Flnc	UTSW	6	29446608	missense	probably damaging	1.00
R6320:Flnc	UTSW	6	29459063	missense	probably damaging	1.00
R6337:Flnc	UTSW	6	29454319	missense	probably damaging	0.99
R6399:Flnc	UTSW	6	29458883	missense	probably damaging	1.00
R6423:Flnc	UTSW	6	29445156	splice site	probably null
R6540:Flnc	UTSW	6	29446377	missense	possibly damaging	0.96
R6547:Flnc	UTSW	6	29448608	missense	probably damaging	0.98
R6717:Flnc	UTSW	6	29450902	small deletion	probably benign
R6875:Flnc	UTSW	6	29445749	missense	probably damaging	1.00
R7193:Flnc	UTSW	6	29450871	missense	probably damaging	1.00
R7255:Flnc	UTSW	6	29445766	missense	probably damaging	1.00
R7303:Flnc	UTSW	6	29460850	missense	probably benign	0.31
R7413:Flnc	UTSW	6	29452259	missense	probably damaging	1.00
R7422:Flnc	UTSW	6	29455471	missense	probably damaging	1.00
R7559:Flnc	UTSW	6	29459010	missense	probably damaging	1.00
R7632:Flnc	UTSW	6	29446985	missense	probably damaging	0.98
R7651:Flnc	UTSW	6	29444050	missense	probably benign	0.08
R7679:Flnc	UTSW	6	29456790	missense	probably benign	0.00
R7697:Flnc	UTSW	6	29456517	missense	probably damaging	0.98
R7788:Flnc	UTSW	6	29456444	missense	possibly damaging	0.67
R7852:Flnc	UTSW	6	29440898	missense	probably damaging	1.00
R7870:Flnc	UTSW	6	29454307	missense	probably damaging	1.00
R7873:Flnc	UTSW	6	29456991	missense	possibly damaging	0.88
R7921:Flnc	UTSW	6	29447770	missense	possibly damaging	0.58
R7950:Flnc	UTSW	6	29456382	missense	possibly damaging	0.61
R7953:Flnc	UTSW	6	29447829	missense	probably damaging	0.99
R7970:Flnc	UTSW	6	29447526	missense	possibly damaging	0.96
R8071:Flnc	UTSW	6	29457446	missense	probably damaging	1.00
R8143:Flnc	UTSW	6	29441485	missense	probably benign	0.20
R8166:Flnc	UTSW	6	29433732	missense	probably damaging	0.99
R8167:Flnc	UTSW	6	29455922	missense	probably damaging	0.98
R8306:Flnc	UTSW	6	29449370	missense	probably benign	0.05
R8428:Flnc	UTSW	6	29450850	missense	probably benign	0.36
Z1088:Flnc	UTSW	6	29457151	missense	probably damaging	1.00
Z1177:Flnc	UTSW	6	29447545	missense	probably damaging	1.00
Z1177:Flnc	UTSW	6	29457130	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACATTGCTTGGCTGGTACC -3'
(R):5'- ATATACCTTCACCCGCTCAGG -3'

Sequencing Primer
(F):5'- CTGGTACCCACAGGATGCAGATG -3'
(R):5'- ACATTCACCTGTGGGCAG -3'

Posted On

2015-10-08