Incidental Mutation 'R4676:Flnc'
ID 349567
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Name filamin C, gamma
Synonyms 1110055E19Rik, Fln2, actin binding protein 280
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 29433255-29461882 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 29445153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000065090
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101617
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29,459,546 (GRCm39) nonsense probably null
IGL01099:Flnc APN 6 29,433,617 (GRCm39) missense probably damaging 0.99
IGL01656:Flnc APN 6 29,443,507 (GRCm39) splice site probably benign
IGL01659:Flnc APN 6 29,448,670 (GRCm39) missense probably damaging 0.98
IGL01780:Flnc APN 6 29,438,492 (GRCm39) nonsense probably null
IGL01935:Flnc APN 6 29,454,279 (GRCm39) missense probably damaging 1.00
IGL02039:Flnc APN 6 29,450,718 (GRCm39) missense probably benign 0.05
IGL02119:Flnc APN 6 29,447,511 (GRCm39) missense probably damaging 0.98
IGL02122:Flnc APN 6 29,444,335 (GRCm39) missense possibly damaging 0.70
IGL02236:Flnc APN 6 29,454,375 (GRCm39) missense probably damaging 1.00
IGL02350:Flnc APN 6 29,438,492 (GRCm39) nonsense probably null
IGL02357:Flnc APN 6 29,438,492 (GRCm39) nonsense probably null
IGL02428:Flnc APN 6 29,451,484 (GRCm39) missense probably damaging 1.00
IGL02496:Flnc APN 6 29,440,684 (GRCm39) missense probably damaging 0.98
IGL02516:Flnc APN 6 29,450,840 (GRCm39) missense probably damaging 0.99
IGL02696:Flnc APN 6 29,446,697 (GRCm39) missense probably damaging 0.98
IGL03165:Flnc APN 6 29,449,377 (GRCm39) missense probably damaging 1.00
IGL03190:Flnc APN 6 29,445,636 (GRCm39) splice site probably benign
I1329:Flnc UTSW 6 29,451,414 (GRCm39) missense probably damaging 1.00
R0111:Flnc UTSW 6 29,454,339 (GRCm39) missense probably damaging 0.99
R0665:Flnc UTSW 6 29,455,530 (GRCm39) missense probably damaging 1.00
R0748:Flnc UTSW 6 29,446,343 (GRCm39) missense probably damaging 0.99
R0960:Flnc UTSW 6 29,441,511 (GRCm39) missense probably damaging 1.00
R1328:Flnc UTSW 6 29,438,612 (GRCm39) missense probably damaging 1.00
R1502:Flnc UTSW 6 29,438,693 (GRCm39) missense probably benign 0.45
R1544:Flnc UTSW 6 29,444,079 (GRCm39) missense probably benign 0.00
R1565:Flnc UTSW 6 29,455,170 (GRCm39) missense probably damaging 1.00
R1640:Flnc UTSW 6 29,433,806 (GRCm39) missense possibly damaging 0.78
R1691:Flnc UTSW 6 29,441,213 (GRCm39) missense probably benign 0.09
R1818:Flnc UTSW 6 29,457,447 (GRCm39) missense probably damaging 1.00
R1826:Flnc UTSW 6 29,455,184 (GRCm39) missense probably damaging 0.99
R1851:Flnc UTSW 6 29,443,478 (GRCm39) missense probably damaging 1.00
R1898:Flnc UTSW 6 29,438,665 (GRCm39) nonsense probably null
R1905:Flnc UTSW 6 29,459,459 (GRCm39) missense probably damaging 1.00
R1985:Flnc UTSW 6 29,444,415 (GRCm39) splice site probably benign
R2016:Flnc UTSW 6 29,443,796 (GRCm39) critical splice donor site probably null
R2017:Flnc UTSW 6 29,443,796 (GRCm39) critical splice donor site probably null
R2020:Flnc UTSW 6 29,444,362 (GRCm39) missense probably damaging 0.97
R2104:Flnc UTSW 6 29,450,734 (GRCm39) critical splice donor site probably null
R2132:Flnc UTSW 6 29,443,675 (GRCm39) missense probably damaging 1.00
R2141:Flnc UTSW 6 29,448,674 (GRCm39) missense probably damaging 1.00
R2197:Flnc UTSW 6 29,459,134 (GRCm39) missense probably damaging 1.00
R2202:Flnc UTSW 6 29,459,507 (GRCm39) missense probably damaging 1.00
R2203:Flnc UTSW 6 29,459,507 (GRCm39) missense probably damaging 1.00
R2204:Flnc UTSW 6 29,459,507 (GRCm39) missense probably damaging 1.00
R2205:Flnc UTSW 6 29,459,507 (GRCm39) missense probably damaging 1.00
R2209:Flnc UTSW 6 29,455,844 (GRCm39) missense possibly damaging 0.91
R2248:Flnc UTSW 6 29,451,400 (GRCm39) missense probably damaging 0.99
R2258:Flnc UTSW 6 29,438,665 (GRCm39) nonsense probably null
R2259:Flnc UTSW 6 29,438,665 (GRCm39) nonsense probably null
R2280:Flnc UTSW 6 29,438,665 (GRCm39) nonsense probably null
R2281:Flnc UTSW 6 29,438,665 (GRCm39) nonsense probably null
R2873:Flnc UTSW 6 29,447,542 (GRCm39) missense probably damaging 0.96
R2900:Flnc UTSW 6 29,448,584 (GRCm39) missense probably damaging 0.98
R3788:Flnc UTSW 6 29,454,056 (GRCm39) missense probably damaging 0.99
R3799:Flnc UTSW 6 29,443,738 (GRCm39) missense probably damaging 1.00
R3801:Flnc UTSW 6 29,447,403 (GRCm39) missense probably damaging 0.98
R3851:Flnc UTSW 6 29,453,718 (GRCm39) missense probably damaging 1.00
R3910:Flnc UTSW 6 29,459,426 (GRCm39) missense probably damaging 1.00
R3982:Flnc UTSW 6 29,442,940 (GRCm39) missense probably damaging 1.00
R3983:Flnc UTSW 6 29,442,940 (GRCm39) missense probably damaging 1.00
R4023:Flnc UTSW 6 29,451,634 (GRCm39) missense possibly damaging 0.95
R4694:Flnc UTSW 6 29,443,447 (GRCm39) missense probably damaging 1.00
R4695:Flnc UTSW 6 29,440,428 (GRCm39) missense probably damaging 0.99
R4735:Flnc UTSW 6 29,455,812 (GRCm39) missense probably damaging 1.00
R4773:Flnc UTSW 6 29,445,038 (GRCm39) missense possibly damaging 0.96
R4828:Flnc UTSW 6 29,455,166 (GRCm39) missense probably damaging 1.00
R4856:Flnc UTSW 6 29,447,889 (GRCm39) missense probably damaging 1.00
R4879:Flnc UTSW 6 29,460,805 (GRCm39) missense probably damaging 0.99
R4899:Flnc UTSW 6 29,446,842 (GRCm39) missense probably benign 0.17
R4906:Flnc UTSW 6 29,447,524 (GRCm39) missense probably damaging 0.99
R5089:Flnc UTSW 6 29,447,812 (GRCm39) missense probably damaging 0.96
R5173:Flnc UTSW 6 29,455,537 (GRCm39) missense probably damaging 1.00
R5174:Flnc UTSW 6 29,448,893 (GRCm39) missense possibly damaging 0.91
R5290:Flnc UTSW 6 29,457,553 (GRCm39) missense probably damaging 1.00
R5338:Flnc UTSW 6 29,444,063 (GRCm39) missense possibly damaging 0.47
R5352:Flnc UTSW 6 29,449,317 (GRCm39) missense possibly damaging 0.85
R5397:Flnc UTSW 6 29,441,160 (GRCm39) missense possibly damaging 0.87
R5431:Flnc UTSW 6 29,456,383 (GRCm39) missense possibly damaging 0.74
R5481:Flnc UTSW 6 29,441,216 (GRCm39) missense probably damaging 1.00
R5511:Flnc UTSW 6 29,458,897 (GRCm39) missense probably damaging 1.00
R5539:Flnc UTSW 6 29,446,229 (GRCm39) missense probably damaging 1.00
R5549:Flnc UTSW 6 29,453,690 (GRCm39) missense probably damaging 1.00
R5567:Flnc UTSW 6 29,444,044 (GRCm39) nonsense probably null
R5584:Flnc UTSW 6 29,446,627 (GRCm39) missense probably damaging 0.98
R5689:Flnc UTSW 6 29,441,591 (GRCm39) missense probably benign 0.03
R5753:Flnc UTSW 6 29,433,488 (GRCm39) missense probably benign
R5786:Flnc UTSW 6 29,459,536 (GRCm39) nonsense probably null
R5822:Flnc UTSW 6 29,459,429 (GRCm39) missense probably damaging 0.98
R5823:Flnc UTSW 6 29,461,201 (GRCm39) missense probably damaging 0.99
R5933:Flnc UTSW 6 29,441,105 (GRCm39) missense probably damaging 0.99
R6043:Flnc UTSW 6 29,446,607 (GRCm39) missense probably damaging 1.00
R6320:Flnc UTSW 6 29,459,062 (GRCm39) missense probably damaging 1.00
R6337:Flnc UTSW 6 29,454,318 (GRCm39) missense probably damaging 0.99
R6399:Flnc UTSW 6 29,458,882 (GRCm39) missense probably damaging 1.00
R6423:Flnc UTSW 6 29,445,155 (GRCm39) splice site probably null
R6540:Flnc UTSW 6 29,446,376 (GRCm39) missense possibly damaging 0.96
R6547:Flnc UTSW 6 29,448,607 (GRCm39) missense probably damaging 0.98
R6717:Flnc UTSW 6 29,450,901 (GRCm39) small deletion probably benign
R6875:Flnc UTSW 6 29,445,748 (GRCm39) missense probably damaging 1.00
R7193:Flnc UTSW 6 29,450,870 (GRCm39) missense probably damaging 1.00
R7255:Flnc UTSW 6 29,445,765 (GRCm39) missense probably damaging 1.00
R7303:Flnc UTSW 6 29,460,849 (GRCm39) missense probably benign 0.31
R7413:Flnc UTSW 6 29,452,258 (GRCm39) missense probably damaging 1.00
R7422:Flnc UTSW 6 29,455,470 (GRCm39) missense probably damaging 1.00
R7559:Flnc UTSW 6 29,459,009 (GRCm39) missense probably damaging 1.00
R7632:Flnc UTSW 6 29,446,984 (GRCm39) missense probably damaging 0.98
R7651:Flnc UTSW 6 29,444,049 (GRCm39) missense probably benign 0.08
R7679:Flnc UTSW 6 29,456,789 (GRCm39) missense probably benign 0.00
R7697:Flnc UTSW 6 29,456,516 (GRCm39) missense probably damaging 0.98
R7788:Flnc UTSW 6 29,456,443 (GRCm39) missense possibly damaging 0.67
R7852:Flnc UTSW 6 29,440,897 (GRCm39) missense probably damaging 1.00
R7870:Flnc UTSW 6 29,454,306 (GRCm39) missense probably damaging 1.00
R7873:Flnc UTSW 6 29,456,990 (GRCm39) missense possibly damaging 0.88
R7921:Flnc UTSW 6 29,447,769 (GRCm39) missense possibly damaging 0.58
R7950:Flnc UTSW 6 29,456,381 (GRCm39) missense possibly damaging 0.61
R7953:Flnc UTSW 6 29,447,828 (GRCm39) missense probably damaging 0.99
R7970:Flnc UTSW 6 29,447,525 (GRCm39) missense possibly damaging 0.96
R8071:Flnc UTSW 6 29,457,445 (GRCm39) missense probably damaging 1.00
R8143:Flnc UTSW 6 29,441,484 (GRCm39) missense probably benign 0.20
R8166:Flnc UTSW 6 29,433,731 (GRCm39) missense probably damaging 0.99
R8167:Flnc UTSW 6 29,455,921 (GRCm39) missense probably damaging 0.98
R8306:Flnc UTSW 6 29,449,369 (GRCm39) missense probably benign 0.05
R8428:Flnc UTSW 6 29,450,849 (GRCm39) missense probably benign 0.36
R8466:Flnc UTSW 6 29,438,621 (GRCm39) missense probably damaging 0.98
R8671:Flnc UTSW 6 29,443,501 (GRCm39) critical splice donor site probably null
R8885:Flnc UTSW 6 29,455,410 (GRCm39) missense probably damaging 0.96
R8922:Flnc UTSW 6 29,456,835 (GRCm39) missense probably damaging 0.99
R8923:Flnc UTSW 6 29,452,236 (GRCm39) missense probably damaging 1.00
R8985:Flnc UTSW 6 29,440,499 (GRCm39) missense probably benign 0.37
R9075:Flnc UTSW 6 29,447,646 (GRCm39) missense probably damaging 0.96
R9098:Flnc UTSW 6 29,455,518 (GRCm39) nonsense probably null
R9162:Flnc UTSW 6 29,455,860 (GRCm39) missense probably damaging 1.00
R9199:Flnc UTSW 6 29,441,490 (GRCm39) missense probably benign 0.31
R9204:Flnc UTSW 6 29,452,353 (GRCm39) missense possibly damaging 0.93
R9273:Flnc UTSW 6 29,447,815 (GRCm39) missense probably benign 0.08
R9411:Flnc UTSW 6 29,441,484 (GRCm39) missense probably benign
R9412:Flnc UTSW 6 29,441,484 (GRCm39) missense probably benign
R9413:Flnc UTSW 6 29,441,484 (GRCm39) missense probably benign
R9451:Flnc UTSW 6 29,445,462 (GRCm39) missense probably damaging 0.98
R9524:Flnc UTSW 6 29,461,109 (GRCm39) missense probably damaging 1.00
R9575:Flnc UTSW 6 29,454,399 (GRCm39) missense probably damaging 0.98
R9582:Flnc UTSW 6 29,460,736 (GRCm39) missense probably damaging 0.99
R9595:Flnc UTSW 6 29,433,720 (GRCm39) missense probably benign 0.05
R9664:Flnc UTSW 6 29,457,214 (GRCm39) missense probably damaging 1.00
R9665:Flnc UTSW 6 29,455,447 (GRCm39) missense probably damaging 1.00
R9686:Flnc UTSW 6 29,456,434 (GRCm39) missense possibly damaging 0.84
Z1088:Flnc UTSW 6 29,457,150 (GRCm39) missense probably damaging 1.00
Z1177:Flnc UTSW 6 29,457,129 (GRCm39) missense probably damaging 1.00
Z1177:Flnc UTSW 6 29,447,544 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTGCTTGGCTGGTACC -3'
(R):5'- ATATACCTTCACCCGCTCAGG -3'

Sequencing Primer
(F):5'- CTGGTACCCACAGGATGCAGATG -3'
(R):5'- ACATTCACCTGTGGGCAG -3'
Posted On 2015-10-08