Incidental Mutation 'R4676:Nlrp4a'
ID 349572
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26149654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 420 (R420S)
Ref Sequence ENSEMBL: ENSMUSP00000112441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably damaging
Transcript: ENSMUST00000068767
AA Change: R420S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: R420S

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119386
AA Change: R420S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: R420S

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: R420S

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.3617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGTCAGGTCCCTGTGCTC -3'
(R):5'- TTTAACCTCCTGGCTAGGGTGG -3'

Sequencing Primer
(F):5'- TGGTGGCTACTTGTCTAAAAGAAG -3'
(R):5'- GGTCCACGTGGCTCTTTAG -3'
Posted On 2015-10-08