Incidental Mutation 'R4676:Clcn3'
ID 349579
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Name chloride channel, voltage-sensitive 3
Synonyms Clc3
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.456) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 61363423-61436334 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 61383685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004430
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056508
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110302
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147824
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 61,375,826 (GRCm39) missense probably damaging 0.99
IGL01088:Clcn3 APN 8 61,390,381 (GRCm39) missense probably damaging 1.00
IGL01449:Clcn3 APN 8 61,387,632 (GRCm39) missense probably damaging 0.97
IGL01792:Clcn3 APN 8 61,382,356 (GRCm39) missense probably damaging 1.00
IGL01845:Clcn3 APN 8 61,366,129 (GRCm39) missense probably benign 0.08
IGL01984:Clcn3 APN 8 61,382,614 (GRCm39) missense probably damaging 1.00
IGL02041:Clcn3 APN 8 61,376,187 (GRCm39) missense probably damaging 0.99
IGL02199:Clcn3 APN 8 61,380,308 (GRCm39) missense possibly damaging 0.82
IGL02199:Clcn3 APN 8 61,386,126 (GRCm39) nonsense probably null
IGL02456:Clcn3 APN 8 61,394,391 (GRCm39) missense probably damaging 1.00
IGL03353:Clcn3 APN 8 61,376,022 (GRCm39) missense probably benign 0.37
Precipice UTSW 8 61,394,433 (GRCm39) missense probably benign 0.16
R0003:Clcn3 UTSW 8 61,380,330 (GRCm39) nonsense probably null
R0023:Clcn3 UTSW 8 61,386,104 (GRCm39) splice site probably benign
R0023:Clcn3 UTSW 8 61,386,104 (GRCm39) splice site probably benign
R0349:Clcn3 UTSW 8 61,394,382 (GRCm39) missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 61,387,571 (GRCm39) missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 61,382,237 (GRCm39) missense probably benign 0.25
R0840:Clcn3 UTSW 8 61,382,188 (GRCm39) missense probably benign 0.22
R1167:Clcn3 UTSW 8 61,375,822 (GRCm39) critical splice donor site probably null
R2035:Clcn3 UTSW 8 61,387,632 (GRCm39) missense probably damaging 0.97
R2193:Clcn3 UTSW 8 61,382,221 (GRCm39) missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 61,366,157 (GRCm39) missense probably benign 0.02
R3736:Clcn3 UTSW 8 61,436,686 (GRCm39) unclassified probably benign
R4807:Clcn3 UTSW 8 61,387,564 (GRCm39) missense probably damaging 1.00
R5112:Clcn3 UTSW 8 61,407,586 (GRCm39) missense probably benign 0.07
R5200:Clcn3 UTSW 8 61,376,039 (GRCm39) missense probably damaging 0.99
R5652:Clcn3 UTSW 8 61,372,387 (GRCm39) missense possibly damaging 0.81
R5712:Clcn3 UTSW 8 61,390,332 (GRCm39) critical splice donor site probably null
R5731:Clcn3 UTSW 8 61,375,923 (GRCm39) missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 61,387,607 (GRCm39) missense probably damaging 1.00
R6134:Clcn3 UTSW 8 61,387,607 (GRCm39) missense probably damaging 1.00
R6370:Clcn3 UTSW 8 61,376,058 (GRCm39) missense probably damaging 1.00
R6371:Clcn3 UTSW 8 61,390,369 (GRCm39) missense probably benign 0.06
R6394:Clcn3 UTSW 8 61,394,325 (GRCm39) missense probably damaging 0.99
R6466:Clcn3 UTSW 8 61,382,595 (GRCm39) missense probably damaging 1.00
R6588:Clcn3 UTSW 8 61,367,861 (GRCm39) missense probably benign 0.03
R6750:Clcn3 UTSW 8 61,367,809 (GRCm39) missense possibly damaging 0.93
R7522:Clcn3 UTSW 8 61,394,446 (GRCm39) missense probably benign
R7556:Clcn3 UTSW 8 61,382,521 (GRCm39) missense probably damaging 0.99
R7557:Clcn3 UTSW 8 61,390,402 (GRCm39) missense probably damaging 0.99
R7685:Clcn3 UTSW 8 61,386,119 (GRCm39) missense possibly damaging 0.54
R7887:Clcn3 UTSW 8 61,394,433 (GRCm39) missense probably benign 0.16
R8219:Clcn3 UTSW 8 61,376,000 (GRCm39) missense probably damaging 0.98
R8478:Clcn3 UTSW 8 61,372,522 (GRCm39) missense probably benign
R8825:Clcn3 UTSW 8 61,382,522 (GRCm39) missense probably damaging 0.99
R9132:Clcn3 UTSW 8 61,382,136 (GRCm39) missense probably damaging 0.99
R9313:Clcn3 UTSW 8 61,390,503 (GRCm39) missense probably damaging 0.99
R9473:Clcn3 UTSW 8 61,407,651 (GRCm39) missense probably benign 0.01
R9475:Clcn3 UTSW 8 61,387,551 (GRCm39) missense probably damaging 0.96
R9598:Clcn3 UTSW 8 61,366,061 (GRCm39) missense unknown
R9697:Clcn3 UTSW 8 61,372,518 (GRCm39) missense probably damaging 1.00
R9718:Clcn3 UTSW 8 61,390,434 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCTTCCACTGAGTGAAATTC -3'
(R):5'- AATGGCCCTGGGATAGCATG -3'

Sequencing Primer
(F):5'- TTCAAGCTTGGCACCCAG -3'
(R):5'- CCCTGGGATAGCATGGAATAC -3'
Posted On 2015-10-08