Mutagenetix > Incidental Mutation

Incidental Mutation 'R4676:Clcn3'

349579

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

042013-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R4676 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 60930651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004430

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056508

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093490

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110302

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132234

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147824

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	T	A	1: 120,150,652	I13N	probably damaging	Het
Abcd3	T	A	3: 121,774,166	T409S	possibly damaging	Het
Acad12	C	A	5: 121,607,171	W317L	probably damaging	Het
Acap1	T	A	11: 69,889,468	M50L	probably benign	Het
Acvr1b	T	A	15: 101,202,986	V343E	probably damaging	Het
Adgb	C	A	10: 10,426,710	G371W	probably damaging	Het
AF529169	A	G	9: 89,601,553	V597A	probably damaging	Het
Akap9	A	G	5: 4,032,774	K1966R	probably damaging	Het
Akap9	C	T	5: 4,064,515	Q48*	probably null	Het
Ano10	T	C	9: 122,263,787	R159G	probably damaging	Het
Anxa7	T	C	14: 20,467,915	M128V	probably benign	Het
Arhgef40	C	A	14: 51,990,959	C554*	probably null	Het
Asna1	C	T	8: 85,018,873	A219T	probably benign	Het
Atf6	T	C	1: 170,787,410	Y538C	probably damaging	Het
Atp8b1	A	C	18: 64,538,678	D1091E	probably benign	Het
BC034090	A	G	1: 155,226,264	Y85H	possibly damaging	Het
BC067074	C	A	13: 113,368,807	L2157I	probably damaging	Het
BC067074	T	G	13: 113,368,808	L2157R	probably damaging	Het
Bcas2	A	G	3: 103,175,701		probably benign	Het
Bnc2	T	C	4: 84,292,819	N463D	probably damaging	Het
Capn7	A	T	14: 31,359,259	H411L	possibly damaging	Het
Cavin3	T	C	7: 105,481,113	E164G	probably damaging	Het
Ccdc191	T	C	16: 43,939,173		probably benign	Het
Ccdc88b	A	G	19: 6,853,000	V858A	probably benign	Het
Commd6	T	C	14: 101,640,284		probably benign	Het
Cul3	G	A	1: 80,271,674	L561F	probably damaging	Het
Cyfip1	T	A	7: 55,875,013	I131N	probably damaging	Het
Dlgap3	T	A	4: 127,233,761	Y741N	probably damaging	Het
Dnah5	A	T	15: 28,295,260	I1380F	possibly damaging	Het
Dync1h1	G	T	12: 110,662,541	L4177F	probably damaging	Het
Ethe1	G	A	7: 24,607,894	V178M	probably damaging	Het
Flnc	A	T	6: 29,445,154		probably null	Het
Glt8d1	T	C	14: 31,006,692	F26L	probably benign	Het
Gm5493	T	A	17: 22,748,081	D63E	probably benign	Het
Gm9996	T	A	10: 29,143,838		probably benign	Het
Gnl2	T	G	4: 125,053,473	S629R	possibly damaging	Het
Gpbp1l1	T	C	4: 116,590,265	S381P	probably damaging	Het
Igsf10	A	C	3: 59,325,949	F1788V	probably benign	Het
Inpp5d	C	A	1: 87,715,142	P935Q	probably damaging	Het
Itch	A	C	2: 155,199,435	I468L	probably benign	Het
Itga5	A	T	15: 103,357,210	Y192N	probably damaging	Het
Itih3	T	A	14: 30,918,949	Q302L	probably null	Het
Itih3	T	A	14: 30,921,686	Q121L	possibly damaging	Het
Kctd17	T	A	15: 78,435,759		probably benign	Het
Lsm1	T	C	8: 25,793,689	L43P	probably damaging	Het
Magi3	A	T	3: 104,015,825	M1192K	probably benign	Het
Mecom	A	G	3: 30,268,668		probably benign	Het
Mtmr3	A	T	11: 4,527,855	F63Y	probably benign	Het
Naa16	A	G	14: 79,336,348		probably benign	Het
Neto1	A	T	18: 86,398,302	T45S	possibly damaging	Het
Nlrp4a	A	T	7: 26,450,229	R420S	probably damaging	Het
Nr1h4	T	C	10: 89,473,874	D317G	probably damaging	Het
Olfr1497	T	A	19: 13,795,474	I46F	possibly damaging	Het
Olfr1504	C	T	19: 13,887,401	D270N	probably damaging	Het
Olfr920	A	G	9: 38,755,659		probably benign	Het
Pde5a	A	T	3: 122,747,893	M11L	possibly damaging	Het
Plxnb1	G	A	9: 109,110,435	R1416Q	possibly damaging	Het
Polm	A	T	11: 5,835,749	Y141*	probably null	Het
Rxfp1	A	G	3: 79,705,668	F32L	probably damaging	Het
Scrt1	T	A	15: 76,521,668	D13V	possibly damaging	Het
Slc1a7	T	A	4: 107,977,674	V79E	possibly damaging	Het
Snurf	T	C	7: 59,995,522	Q48R	probably benign	Het
Srek1	T	C	13: 103,758,187		probably benign	Het
Stxbp5l	T	C	16: 37,255,884	S267G	probably damaging	Het
Taf5	C	T	19: 47,074,970	R320W	probably damaging	Het
Tars2	A	T	3: 95,753,091	N106K	probably damaging	Het
Tatdn3	A	T	1: 191,049,334	L207Q	probably damaging	Het
Tdrd6	T	C	17: 43,627,610	E849G	probably damaging	Het
Tedc2	T	C	17: 24,220,011	T111A	probably benign	Het
Tfg	T	A	16: 56,694,491		probably null	Het
Tgds	A	T	14: 118,116,231	S225T	probably benign	Het
Tnks2	T	A	19: 36,875,271	Y134*	probably null	Het
Trappc1	T	A	11: 69,325,530	V134D	probably damaging	Het
Ttc3	C	A	16: 94,442,761	P853Q	probably damaging	Het
Ttc7	C	A	17: 87,370,735		probably benign	Het
Ttf1	A	G	2: 29,074,594	S643G	probably damaging	Het
Tubgcp3	A	T	8: 12,650,171	S338T	probably damaging	Het
Ugt1a6a	T	C	1: 88,139,285	I271T	possibly damaging	Het
Vipas39	T	A	12: 87,241,301	Y445F	probably damaging	Het
Vmn1r31	A	C	6: 58,472,013	I289S	probably damaging	Het
Wdr92	T	C	11: 17,229,794	V265A	probably benign	Het
Zfp112	A	G	7: 24,126,260	E551G	probably damaging	Het
Zfp397	T	A	18: 23,960,797	Y446*	probably null	Het
Zfp442	A	T	2: 150,409,606	H124Q	probably damaging	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R0840:Clcn3	UTSW	8	60929154	missense	probably benign	0.22
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5652:Clcn3	UTSW	8	60919353	missense	possibly damaging	0.81
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R7887:Clcn3	UTSW	8	60941399	missense	probably benign	0.16
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign
R8825:Clcn3	UTSW	8	60929488	missense	probably damaging	0.99
R9132:Clcn3	UTSW	8	60929102	missense	probably damaging	0.99
R9313:Clcn3	UTSW	8	60937469	missense	probably damaging	0.99
R9473:Clcn3	UTSW	8	60954617	missense	probably benign	0.01
R9475:Clcn3	UTSW	8	60934517	missense	probably damaging	0.96
R9598:Clcn3	UTSW	8	60913027	missense	unknown
R9697:Clcn3	UTSW	8	60919484	missense	probably damaging	1.00
R9718:Clcn3	UTSW	8	60937400	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGCTTCCACTGAGTGAAATTC -3'
(R):5'- AATGGCCCTGGGATAGCATG -3'

Sequencing Primer
(F):5'- TTCAAGCTTGGCACCCAG -3'
(R):5'- CCCTGGGATAGCATGGAATAC -3'

Posted On

2015-10-08