Incidental Mutation 'R4676:Nr1h4'
ID349587
Institutional Source Beutler Lab
Gene Symbol Nr1h4
Ensembl Gene ENSMUSG00000047638
Gene Namenuclear receptor subfamily 1, group H, member 4
SynonymsRxrip14, FXR, HRR1, Fxr, RIP14
MMRRC Submission 042013-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R4676 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89454234-89533585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89473874 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 317 (D317G)
Ref Sequence ENSEMBL: ENSMUSP00000100934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]
Predicted Effect probably damaging
Transcript: ENSMUST00000058126
AA Change: D327G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: D327G

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 235 285 4e-19 BLAST
HOLI 301 456 9.43e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105296
AA Change: D331G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: D331G

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 239 289 4e-19 BLAST
HOLI 305 460 9.43e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105297
AA Change: D317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: D317G

DomainStartEndE-ValueType
ZnF_C4 121 192 1.93e-37 SMART
Blast:HOLI 225 275 3e-19 BLAST
HOLI 291 446 9.43e-32 SMART
Meta Mutation Damage Score 0.9401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Nr1h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Nr1h4 APN 10 89478807 missense probably benign 0.42
IGL02628:Nr1h4 APN 10 89473839 missense probably damaging 1.00
Aeronaut UTSW 10 89498229 nonsense probably null
I1329:Nr1h4 UTSW 10 89483362 splice site probably benign
IGL02837:Nr1h4 UTSW 10 89516480 missense probably benign 0.00
R0590:Nr1h4 UTSW 10 89456567 missense probably damaging 0.99
R0645:Nr1h4 UTSW 10 89506528 missense probably benign 0.08
R1887:Nr1h4 UTSW 10 89454867 missense possibly damaging 0.64
R1905:Nr1h4 UTSW 10 89480559 missense possibly damaging 0.85
R2471:Nr1h4 UTSW 10 89473894 missense probably damaging 1.00
R2921:Nr1h4 UTSW 10 89498361 missense probably damaging 1.00
R3177:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R3277:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R4656:Nr1h4 UTSW 10 89498253 missense probably benign 0.00
R4901:Nr1h4 UTSW 10 89478797 missense possibly damaging 0.68
R4993:Nr1h4 UTSW 10 89498180 missense probably benign 0.01
R5117:Nr1h4 UTSW 10 89478422 missense probably damaging 1.00
R5131:Nr1h4 UTSW 10 89483455 missense probably damaging 0.99
R5176:Nr1h4 UTSW 10 89498255 missense probably benign 0.02
R5241:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
R5580:Nr1h4 UTSW 10 89516440 missense probably benign 0.16
R6114:Nr1h4 UTSW 10 89478816 missense possibly damaging 0.61
R6814:Nr1h4 UTSW 10 89454745 missense probably damaging 0.98
R6888:Nr1h4 UTSW 10 89456542 missense probably damaging 1.00
R6990:Nr1h4 UTSW 10 89454930 missense probably benign 0.18
R7141:Nr1h4 UTSW 10 89498229 nonsense probably null
R7427:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7428:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7560:Nr1h4 UTSW 10 89498261 missense probably benign
R7986:Nr1h4 UTSW 10 89454772 missense possibly damaging 0.46
X0023:Nr1h4 UTSW 10 89454844 missense possibly damaging 0.45
Z1176:Nr1h4 UTSW 10 89498350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCTGGTAGATTAGGGCC -3'
(R):5'- ACAGGAATCCAGTTGACTCCCC -3'

Sequencing Primer
(F):5'- CTTCATGGTTTGAACGCCAAG -3'
(R):5'- GTTGACTCCCCCTGAAGAC -3'
Posted On2015-10-08