Incidental Mutation 'R4676:Kctd17'
ID 349609
Institutional Source Beutler Lab
Gene Symbol Kctd17
Ensembl Gene ENSMUSG00000033287
Gene Name potassium channel tetramerisation domain containing 17
Synonyms 2900008M13Rik
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78312764-78323503 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 78319959 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000089414] [ENSMUST00000159771] [ENSMUST00000162321] [ENSMUST00000162517] [ENSMUST00000229290] [ENSMUST00000166142] [ENSMUST00000230020] [ENSMUST00000229622] [ENSMUST00000230226]
AlphaFold E0CYQ0
Predicted Effect probably benign
Transcript: ENSMUST00000017086
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089414
SMART Domains Protein: ENSMUSP00000086835
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
coiled coil region 208 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159771
SMART Domains Protein: ENSMUSP00000125574
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
BTB 24 125 1.76e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161016
Predicted Effect probably benign
Transcript: ENSMUST00000162321
SMART Domains Protein: ENSMUSP00000125680
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
BTB 3 86 9.93e-2 SMART
low complexity region 168 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162517
SMART Domains Protein: ENSMUSP00000124290
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
low complexity region 227 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162605
Predicted Effect probably benign
Transcript: ENSMUST00000162808
SMART Domains Protein: ENSMUSP00000125421
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
SCOP:d3kvt__ 2 36 3e-8 SMART
Blast:BTB 2 98 6e-30 BLAST
PDB:3DRY|E 2 127 4e-69 PDB
low complexity region 130 157 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229290
Predicted Effect probably benign
Transcript: ENSMUST00000166142
SMART Domains Protein: ENSMUSP00000133210
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230020
Predicted Effect probably benign
Transcript: ENSMUST00000229622
Predicted Effect probably benign
Transcript: ENSMUST00000230226
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Tnks2 T A 19: 36,852,671 (GRCm39) Y134* probably null Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Kctd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Kctd17 APN 15 78,314,356 (GRCm39) splice site probably benign
IGL02209:Kctd17 APN 15 78,319,792 (GRCm39) missense probably damaging 1.00
IGL03132:Kctd17 APN 15 78,319,887 (GRCm39) missense probably damaging 1.00
R4793:Kctd17 UTSW 15 78,317,224 (GRCm39) missense probably damaging 1.00
R5428:Kctd17 UTSW 15 78,312,982 (GRCm39) missense probably damaging 1.00
R5590:Kctd17 UTSW 15 78,321,502 (GRCm39) unclassified probably benign
R5779:Kctd17 UTSW 15 78,321,333 (GRCm39) unclassified probably benign
R6249:Kctd17 UTSW 15 78,314,239 (GRCm39) splice site probably null
R6911:Kctd17 UTSW 15 78,318,206 (GRCm39) missense probably damaging 1.00
R7266:Kctd17 UTSW 15 78,317,214 (GRCm39) missense probably damaging 1.00
R7324:Kctd17 UTSW 15 78,319,842 (GRCm39) missense probably damaging 1.00
R7706:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7707:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7967:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7968:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7970:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7972:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7973:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8097:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8098:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8099:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8100:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8333:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R9025:Kctd17 UTSW 15 78,314,282 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACATCGGCTCCTCCTAC -3'
(R):5'- TCAGTGTGCTCTACTTCGTG -3'

Sequencing Primer
(F):5'- TCCTCCTACAACTATGGGAGTGAG -3'
(R):5'- TTGATGCCACGTGATTGAAAAGC -3'
Posted On 2015-10-08