Incidental Mutation 'R4676:Olfr1497'
ID349625
Institutional Source Beutler Lab
Gene Symbol Olfr1497
Ensembl Gene ENSMUSG00000044040
Gene Nameolfactory receptor 1497
SynonymsGA_x6K02T2RE5P-4127765-4126821, MOR212-1
MMRRC Submission 042013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4676 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13794324-13798202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13795474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 46 (I46F)
Ref Sequence ENSEMBL: ENSMUSP00000149151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061993] [ENSMUST00000217384]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061993
AA Change: I46F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053465
Gene: ENSMUSG00000044040
AA Change: I46F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 302 7e-7 PFAM
Pfam:7tm_1 41 290 5.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217384
AA Change: I46F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1955 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Ano10 T C 9: 122,263,787 R159G probably damaging Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Olfr1497
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1497 APN 19 13795329 missense possibly damaging 0.69
IGL02471:Olfr1497 APN 19 13795225 missense probably damaging 1.00
R0167:Olfr1497 UTSW 19 13795567 missense probably benign 0.03
R0602:Olfr1497 UTSW 19 13794662 splice site probably null
R1448:Olfr1497 UTSW 19 13794776 nonsense probably null
R2211:Olfr1497 UTSW 19 13795369 missense probably benign
R2295:Olfr1497 UTSW 19 13794744 missense probably damaging 1.00
R2340:Olfr1497 UTSW 19 13794771 missense probably benign 0.00
R3773:Olfr1497 UTSW 19 13795204 missense probably benign 0.00
R4596:Olfr1497 UTSW 19 13794900 missense probably damaging 1.00
R4767:Olfr1497 UTSW 19 13795045 missense probably damaging 1.00
R4921:Olfr1497 UTSW 19 13795465 missense probably benign 0.03
R4930:Olfr1497 UTSW 19 13795551 missense probably benign 0.00
R5784:Olfr1497 UTSW 19 13795346 missense probably benign 0.00
R7402:Olfr1497 UTSW 19 13794994 missense probably damaging 1.00
R7473:Olfr1497 UTSW 19 13795162 missense probably benign 0.11
R8140:Olfr1497 UTSW 19 13795239 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAAAGCAATGGTTGGCACAC -3'
(R):5'- CTTGTCTTAGCCCTCACAGG -3'

Sequencing Primer
(F):5'- TCGTAGGCCATGATTGCCAAG -3'
(R):5'- GCCCTCACAGGTAAACTTCTAGATGG -3'
Posted On2015-10-08